ID: 1065287345

View in Genome Browser
Species Human (GRCh38)
Location 10:24198904-24198926
Sequence ATACTGAACATTGCCTCCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 161}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065287345_1065287348 2 Left 1065287345 10:24198904-24198926 CCTTAGGAGGCAATGTTCAGTAT 0: 1
1: 0
2: 0
3: 10
4: 161
Right 1065287348 10:24198929-24198951 CATGAACAAGCCAGGTGTGGTGG No data
1065287345_1065287351 30 Left 1065287345 10:24198904-24198926 CCTTAGGAGGCAATGTTCAGTAT 0: 1
1: 0
2: 0
3: 10
4: 161
Right 1065287351 10:24198957-24198979 GCCTGCAATCCCAGCACTATGGG 0: 23
1: 4848
2: 232391
3: 275349
4: 183422
1065287345_1065287347 -1 Left 1065287345 10:24198904-24198926 CCTTAGGAGGCAATGTTCAGTAT 0: 1
1: 0
2: 0
3: 10
4: 161
Right 1065287347 10:24198926-24198948 TTACATGAACAAGCCAGGTGTGG No data
1065287345_1065287350 29 Left 1065287345 10:24198904-24198926 CCTTAGGAGGCAATGTTCAGTAT 0: 1
1: 0
2: 0
3: 10
4: 161
Right 1065287350 10:24198956-24198978 CGCCTGCAATCCCAGCACTATGG 0: 5
1: 2391
2: 133450
3: 280521
4: 222510
1065287345_1065287346 -6 Left 1065287345 10:24198904-24198926 CCTTAGGAGGCAATGTTCAGTAT 0: 1
1: 0
2: 0
3: 10
4: 161
Right 1065287346 10:24198921-24198943 CAGTATTACATGAACAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065287345 Original CRISPR ATACTGAACATTGCCTCCTA AGG (reversed) Intronic
901321788 1:8344495-8344517 ATTCTGTACATTGCATCCCAGGG + Intergenic
902452527 1:16506252-16506274 AGACTGAAATTTGCCTCCCAAGG + Intergenic
902500217 1:16906035-16906057 AGACTGAAATTTGCCTCCCAAGG - Intronic
906428953 1:45738957-45738979 ATACTGAACAATTGCTCCTAGGG - Intronic
908130812 1:61073660-61073682 ATACTGTCCAGTGCCGCCTAAGG + Intronic
910552382 1:88490435-88490457 ATACTGAACTATTGCTCCTAGGG + Intergenic
911902441 1:103523443-103523465 ATATTTACCACTGCCTCCTACGG - Intergenic
914096121 1:144545646-144545668 AGACTGAAATTTGCCTCCTGAGG + Intergenic
914302400 1:146388316-146388338 AGACTGAAATTTGCCTCCTGAGG - Intergenic
915692670 1:157705323-157705345 ATGTTGAACCTTGCATCCTAGGG + Intergenic
917444603 1:175096417-175096439 ATGCTGAACTTTGCTCCCTAGGG + Intronic
917460784 1:175227241-175227263 ATGCCAAACATTGCCTCCCAGGG + Intergenic
918089186 1:181273608-181273630 ATACTGAACCATTGCTCCTAGGG - Intergenic
919316594 1:195978874-195978896 TTACAGAACATTGCATCCAATGG - Intergenic
920556210 1:206906864-206906886 ATACTGACCATTGACTCCAGAGG - Intronic
921159231 1:212461407-212461429 ATACTGAACCTTTGCGCCTAGGG + Intergenic
921645282 1:217607672-217607694 ATACTGAATCATGGCTCCTAAGG - Intronic
922059552 1:222074781-222074803 ATACTGAACCATCACTCCTACGG + Intergenic
1063086809 10:2827068-2827090 GCACTGAACATTTGCTCCTAGGG + Intergenic
1064092889 10:12400010-12400032 ATACTGAACCATTGCTCCTAGGG - Intronic
1064139223 10:12776500-12776522 ATACTGAACCATTGCTCCTAAGG + Intronic
1065287345 10:24198904-24198926 ATACTGAACATTGCCTCCTAAGG - Intronic
1068541922 10:58304432-58304454 TTACTGCACTTTCCCTCCTAGGG - Intergenic
1070433289 10:76362650-76362672 ATATTGAACATTGCACCCAAAGG + Intronic
1070442218 10:76457809-76457831 ATACTGAACGATTGCTCCTAAGG - Intronic
1071709217 10:88032583-88032605 GTACAGAACATCTCCTCCTATGG - Intergenic
1074846378 10:117402345-117402367 ATTCTGAACATCGCTTCCTTTGG + Intergenic
1079245518 11:18749607-18749629 ATACTGAGCTTTGCCTTCCAGGG - Intronic
1080526293 11:33123780-33123802 ATTCTGAACATTGTCTCTGAGGG + Intronic
1083446416 11:62710573-62710595 CAACTGAACTTAGCCTCCTAAGG + Intronic
1084314220 11:68334980-68335002 ATACTGAACCATTGCTCCTAGGG + Intronic
1084768258 11:71326186-71326208 AGACTGAACATTGCTTCCCACGG - Intergenic
1084933128 11:72572619-72572641 AAACTGAACATTCCTTTCTATGG - Intergenic
1087936710 11:104042619-104042641 ATAGCCCACATTGCCTCCTAGGG - Intronic
1089140997 11:116283907-116283929 ATACTGAACCTTTGTTCCTAGGG + Intergenic
1090219150 11:125000828-125000850 ATACTGAATTTTTGCTCCTAGGG + Intronic
1091003084 11:131927215-131927237 AAATTTAACATTGCATCCTAGGG + Intronic
1093080980 12:14810783-14810805 ATACTGCACACTGCCAACTATGG - Intronic
1093819540 12:23596608-23596630 CTATTGATCATTGCCTCCTTTGG - Intronic
1098793192 12:74853747-74853769 ATACTGAACCATTGCTCCTAGGG - Intergenic
1099423242 12:82490699-82490721 ATACAGAACATTCCTTCCAACGG + Intergenic
1104770361 12:131357922-131357944 ATCTTGAACATTTCCTACTAAGG - Intergenic
1104812936 12:131629229-131629251 AGACTCAACAAGGCCTCCTAGGG + Intergenic
1104831610 12:131756206-131756228 ATACTGAAAATTGGTTCCCAAGG + Intronic
1108480038 13:50859740-50859762 ATATTCAACCTTGCATCCTAGGG - Intergenic
1108740195 13:53329766-53329788 TTTCTAAACATTGCCTTCTATGG + Intergenic
1109933948 13:69256068-69256090 ATACAGAACATTTCATCCAATGG + Intergenic
1110421255 13:75311879-75311901 ATAGAGAACTTCGCCTCCTATGG - Intronic
1110719837 13:78748726-78748748 ATACTGAACAAAGCCACCCAAGG + Intergenic
1113463897 13:110500654-110500676 ATACTGAACCATTGCTCCTAGGG + Intronic
1115134164 14:30089315-30089337 TTACTGAACATTTCATCCAAAGG + Intronic
1115183321 14:30655526-30655548 ATACTGAAAATGGACTCCTTGGG + Intronic
1121987763 14:98524767-98524789 ATAATGAACTTTACCTCCTATGG + Intergenic
1202866283 14_GL000225v1_random:120411-120433 ATATTCAACAATGCCTCCTTTGG - Intergenic
1124322122 15:28722159-28722181 ATACTGATCTTTGTCTCCAAGGG + Intronic
1125117866 15:36116674-36116696 AACCTGAACTTTGCCTCCCAGGG + Intergenic
1125257292 15:37779644-37779666 ATACTGAACCATTGCTCCTAAGG + Intergenic
1125791344 15:42368620-42368642 ATACTGAACCATTGCTCCTAGGG - Intronic
1127809637 15:62552852-62552874 ATACTGAACCTCTGCTCCTAGGG - Intronic
1128859765 15:71058073-71058095 CTACTGAACATTTGCTCCAATGG - Intergenic
1135899985 16:26448522-26448544 GTACTGAGAATTGCCTCCTTGGG + Intergenic
1136420697 16:30130856-30130878 ATACTGAACATTGCTTCTAGCGG - Intergenic
1140599744 16:76460884-76460906 ATACTGAACCTTTGCTCCTGGGG + Intronic
1140646360 16:77035446-77035468 CTACAGAACATTTCATCCTATGG - Intergenic
1157572125 18:48720057-48720079 ATACTGAACTATTACTCCTAGGG - Intronic
1158369136 18:56778434-56778456 ATAATTACCATTACCTCCTAGGG - Intronic
1165053623 19:33159640-33159662 ATACTGAACCATCGCTCCTAGGG - Intronic
1168551861 19:57302769-57302791 AAGCTGCACATTGCCTCCTGAGG - Intergenic
927087909 2:19689495-19689517 ATTCAGATCATTGCCTCCCAGGG - Intergenic
931406542 2:61984635-61984657 TTACAGAACATTTCCTCCAATGG - Intronic
933068378 2:77827683-77827705 TTACAGAACATTACTTCCTATGG - Intergenic
933617890 2:84502495-84502517 ATACAGAACATTTCATCCAATGG - Intergenic
933859612 2:86452466-86452488 ATACTGAACCATTGCTCCTAGGG - Intronic
934725090 2:96611382-96611404 ATACTGAACCTTCTATCCTATGG - Intronic
937424668 2:121788909-121788931 ATACTGAACTATGGCTCCTATGG - Intergenic
938156166 2:128942206-128942228 ATACTAAACATTGCCTTTTTAGG - Intergenic
938798383 2:134737894-134737916 ATACTGTATATTACCTCCGAAGG + Intergenic
939556351 2:143678413-143678435 ATACTGAATATTCCCCTCTAAGG - Intronic
942893656 2:181022383-181022405 ATACTGAACCATTACTCCTAGGG + Intronic
943101501 2:183492387-183492409 ATTCTGAGCATTGGCTCCCATGG + Intergenic
946377934 2:219325176-219325198 ATACTGAACATTTCTCACTAAGG + Intergenic
947788588 2:232848056-232848078 ATACTGAACCATTGCTCCTAGGG + Intronic
948087266 2:235261945-235261967 ATACTGAACCATTGCTCCTAAGG + Intergenic
948546335 2:238731780-238731802 AGACTGCACAGTGCTTCCTAAGG - Intergenic
1169401018 20:5280321-5280343 ATACTGAACCATTGCTCCTAGGG + Intergenic
1173360717 20:42342133-42342155 AGACTGACCTTTGTCTCCTAGGG + Intronic
1174227237 20:49011307-49011329 ATACTGAACCATGGCTCTTAGGG - Intronic
1174651769 20:52131883-52131905 TTACAGAACATTTCATCCTATGG + Intronic
1174660628 20:52209825-52209847 ATACTGAACCATTGCTCCTAGGG + Intergenic
1178048247 21:28720288-28720310 ATACTGAACCATTGCTCCTAGGG - Intergenic
1179200100 21:39209364-39209386 ATATTGAAAGTTGACTCCTAAGG - Intronic
1180210813 21:46294813-46294835 ATACTTAACTTGGCCTCCTTTGG + Intronic
1183383801 22:37503637-37503659 ATACTGACCACAGCCTCCCAGGG + Intronic
1185184367 22:49388637-49388659 ATACTGAACATTTCTTCCTGAGG - Intergenic
950748502 3:15109658-15109680 ATACTAAGAATTGCCTCCTTGGG + Intergenic
951417138 3:22438800-22438822 ATAATAAACCTTGCCTCATAGGG - Intergenic
951973025 3:28469941-28469963 TTACAGAACATTTCATCCTATGG + Intronic
952264469 3:31772128-31772150 ATACTAAACGTTTGCTCCTAGGG + Intronic
952811384 3:37407042-37407064 TTACAGAACATTTCCTCCAATGG - Intronic
956844875 3:73173556-73173578 ATACTGAACCATTGCTCCTAGGG - Intergenic
956967259 3:74476254-74476276 ATACTGAACTATTGCTCCTAAGG - Intronic
957303493 3:78424664-78424686 ATACTGAACAATTGCCCCTAGGG - Intergenic
959155441 3:102661165-102661187 ATACTGAACACTTGCTCCTAGGG + Intergenic
964606734 3:158568430-158568452 AAACTGAAAATTGCCTAATAGGG - Intergenic
964707902 3:159640234-159640256 ATACGGAACATTGATTCCCAGGG + Intronic
964848355 3:161068023-161068045 ATCCTGCACATTGCCTTCCATGG + Intronic
967023470 3:185543504-185543526 ATACTGAACCATTGCTCCTAGGG - Intronic
972364000 4:38356322-38356344 ACACTGAACCTTGTCTCCAAAGG + Intergenic
974528896 4:63081169-63081191 ATATTACACATTTCCTCCTAGGG + Intergenic
974978247 4:68918838-68918860 ATTTTGCACATTGCATCCTATGG + Intergenic
978979854 4:114929917-114929939 ACACTGACCATTGCCTCCCCTGG - Intronic
980511460 4:133794203-133794225 ATATTGAACATTTGCTCTTAAGG + Intergenic
981751570 4:148097379-148097401 ATACTGAACAATTGCTCCTAGGG + Intronic
982586149 4:157242669-157242691 ATACTGAACCATTGCTCCTAGGG + Intronic
984002422 4:174266361-174266383 ATACTGAAAATTGTCCCCTTGGG + Intronic
985980938 5:3462571-3462593 GTACTGAGCATTGCTTCCTGGGG - Intergenic
986278931 5:6306621-6306643 ATATTGGACATTGCTTCCTGAGG + Intergenic
987637124 5:20558275-20558297 ACACTGACAAGTGCCTCCTAAGG + Intronic
990353735 5:54944363-54944385 AAGCTGAAAATTGCATCCTACGG - Intergenic
991347263 5:65682885-65682907 ATACTGAACAATTGTTCCTAGGG + Intronic
995400443 5:111734809-111734831 ATACTGGACTTTGCCTCTTAGGG - Intronic
1001315541 5:170638847-170638869 TTAATGGACATTGCCTCCCAGGG - Intronic
1004341188 6:14808780-14808802 ATACTGAACCATTGCTCCTAGGG + Intergenic
1005058713 6:21756189-21756211 ATACTGAACCATTGCTCCTAGGG + Intergenic
1006734299 6:36261701-36261723 ATAATCAAACTTGCCTCCTAGGG - Intronic
1007093332 6:39198271-39198293 ATAATGATCAATACCTCCTAGGG - Intronic
1009059656 6:58383303-58383325 ATAATGAACAATTGCTCCTAGGG - Intergenic
1009231252 6:61064099-61064121 ATAATGAACAATTGCTCCTAGGG + Intergenic
1010346310 6:74815043-74815065 AAGATGAACACTGCCTCCTACGG + Intergenic
1010631011 6:78198469-78198491 AGACTGAACCTTGGCTCCAATGG + Intergenic
1011743084 6:90382750-90382772 ATTCTAAACATTGCCTCTTGAGG + Intergenic
1012800674 6:103823100-103823122 TTACAGAACATTTCCTCCAATGG + Intergenic
1015721031 6:136242193-136242215 AAACAGAACATAGCCTCCAATGG + Intronic
1015959725 6:138634708-138634730 TTACAGAACATTGCATCCAATGG + Intronic
1016420616 6:143878757-143878779 ATACTGAACTGTGGCTCCTAGGG - Intronic
1017952500 6:159147928-159147950 ATACTGAAGCTTGGCTCCTGGGG + Intergenic
1021102076 7:16595700-16595722 AACCTGAACATTCCCTTCTATGG - Intergenic
1022016236 7:26350762-26350784 AGACTGTAAATTGCCTCTTATGG - Intronic
1022180696 7:27916381-27916403 ATACTGAACCATTGCTCCTAGGG + Intronic
1024306556 7:47934201-47934223 CTACGGAAAATTGCCTCCTTAGG + Intronic
1028788624 7:94826866-94826888 ATACTGAACAATTGTTCCTAGGG + Intergenic
1029006644 7:97217244-97217266 ATACAGAACATCCCCTCCAACGG - Intergenic
1029433024 7:100544456-100544478 ATACTGTACCTTTCCTCCCATGG - Intronic
1031706016 7:124981786-124981808 ATATTGAACCATGCCTCCCAGGG + Intergenic
1036408994 8:8480754-8480776 ATACTGAACCATTGCTCCTAGGG + Intergenic
1036942108 8:13061530-13061552 ATACTGAACCATTGCTCCTAGGG + Intergenic
1037121252 8:15290065-15290087 ACAGTGCACATTGCCTCTTAAGG + Intergenic
1039827426 8:41186810-41186832 ATACTGAACCATTGCTCCTAGGG + Intergenic
1044189911 8:89303254-89303276 ATACTGAACCACTCCTCCTAAGG - Intergenic
1044580336 8:93819969-93819991 AAGAGGAACATTGCCTCCTAGGG - Intergenic
1046223248 8:111242488-111242510 ATATTGAACACTGCCTTCTTGGG - Intergenic
1048362908 8:133713525-133713547 TTTCTCAACATGGCCTCCTAAGG - Intergenic
1048577123 8:135701670-135701692 AAACTGCACACTGCCTCCTGAGG - Intergenic
1048676515 8:136789061-136789083 TTACTGAAAATTTCTTCCTAAGG - Intergenic
1051094544 9:13451249-13451271 ATACAGAACATTGCCACATTGGG + Intergenic
1051958207 9:22725088-22725110 ATATTGAACAATTGCTCCTAAGG + Intergenic
1051990128 9:23143008-23143030 ATGCTGAACATTGCTTACTATGG - Intergenic
1061166391 9:128925031-128925053 AAGCTGAAAATTGCCTCCTTGGG - Intronic
1203738057 Un_GL000216v2:155815-155837 ATATTCAACAATGCCTCCTTTGG + Intergenic
1187592326 X:20731881-20731903 AGACTGGACATTGCCTCAAATGG - Intergenic
1188162693 X:26822108-26822130 AAAGTGCACATTGCCTCCCAGGG - Intergenic
1188393320 X:29648301-29648323 ATACAGAACATTCCATCCAACGG + Intronic
1188924272 X:36020312-36020334 ATACAGAACATTTCATCCAATGG - Intergenic
1189125674 X:38443441-38443463 ATACTGAACTATCACTCCTAGGG + Intronic
1189140266 X:38597660-38597682 ATACTGAACCATTGCTCCTAGGG - Intronic
1189529104 X:41859878-41859900 ATACTGAACCATTGCTCCTAGGG - Intronic
1193342146 X:80361362-80361384 ATACTGAACCATTGCTCCTAGGG - Intronic
1196641656 X:118069163-118069185 AAACTGAAAATTGCCCCCTTGGG + Intronic
1197341323 X:125269690-125269712 TTACCGAACATTGCATCCAATGG - Intergenic
1198540292 X:137631431-137631453 ACACTGAACATTCCCTCTCAGGG + Intergenic
1199550678 X:149057650-149057672 CTACTGAACATTTTCACCTATGG + Intergenic
1202126488 Y:21573231-21573253 ATACTGACCATGGGCTCATAGGG - Intergenic