ID: 1065287346

View in Genome Browser
Species Human (GRCh38)
Location 10:24198921-24198943
Sequence CAGTATTACATGAACAAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065287340_1065287346 23 Left 1065287340 10:24198875-24198897 CCTAAAGCAGTACTCTCCGAACT 0: 1
1: 0
2: 0
3: 2
4: 93
Right 1065287346 10:24198921-24198943 CAGTATTACATGAACAAGCCAGG No data
1065287345_1065287346 -6 Left 1065287345 10:24198904-24198926 CCTTAGGAGGCAATGTTCAGTAT 0: 1
1: 0
2: 0
3: 10
4: 161
Right 1065287346 10:24198921-24198943 CAGTATTACATGAACAAGCCAGG No data
1065287343_1065287346 7 Left 1065287343 10:24198891-24198913 CCGAACTACTAGGCCTTAGGAGG 0: 1
1: 0
2: 0
3: 4
4: 74
Right 1065287346 10:24198921-24198943 CAGTATTACATGAACAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065287346 Original CRISPR CAGTATTACATGAACAAGCC AGG Intronic
No off target data available for this crispr