ID: 1065289246

View in Genome Browser
Species Human (GRCh38)
Location 10:24213775-24213797
Sequence CCAGTGATGAAGAGGATTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 187}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065289246_1065289251 16 Left 1065289246 10:24213775-24213797 CCAGAAATCCTCTTCATCACTGG 0: 1
1: 0
2: 0
3: 10
4: 187
Right 1065289251 10:24213814-24213836 TATAGAGGAATATAATGACCTGG No data
1065289246_1065289250 1 Left 1065289246 10:24213775-24213797 CCAGAAATCCTCTTCATCACTGG 0: 1
1: 0
2: 0
3: 10
4: 187
Right 1065289250 10:24213799-24213821 AAAATTTTAAGGTACTATAGAGG No data
1065289246_1065289249 -10 Left 1065289246 10:24213775-24213797 CCAGAAATCCTCTTCATCACTGG 0: 1
1: 0
2: 0
3: 10
4: 187
Right 1065289249 10:24213788-24213810 TCATCACTGGTAAAATTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065289246 Original CRISPR CCAGTGATGAAGAGGATTTC TGG (reversed) Intronic
900717748 1:4156206-4156228 CCAGTGGGGAAGAGGGTTTGGGG + Intergenic
904901241 1:33858760-33858782 CCAGTGATGAACAGTGTTTGAGG - Intronic
906490377 1:46263672-46263694 ACAGTGATGAAGCAGATGTCAGG - Intronic
909301073 1:74014343-74014365 AGAGTTATGGAGAGGATTTCTGG + Intergenic
909894973 1:81057438-81057460 CCTGTGATGCTGAGGATTACAGG + Intergenic
911452873 1:98087246-98087268 CAAGTAAAGAAGAGGATTTGTGG + Intergenic
911958296 1:104265338-104265360 CCAGTGATGTACATGATTCCTGG + Intergenic
915021301 1:152782066-152782088 TCAGTGTTGGAGAGGATTTGTGG - Intronic
915213692 1:154326991-154327013 TCAGGGATGAAAAGGACTTCTGG + Intronic
917635957 1:176936488-176936510 TCTTTGATGAAGAGAATTTCTGG + Intronic
918626209 1:186658564-186658586 GGAGTGGTGAAGATGATTTCAGG + Intergenic
924434530 1:244027449-244027471 CTAGAGATGAAGAGGCTTTATGG - Intergenic
1063816387 10:9779027-9779049 CAAGTGATGAAGCTGAATTCAGG + Intergenic
1065127713 10:22590300-22590322 CCAGTTGTGAAGATGATTCCTGG + Intronic
1065289246 10:24213775-24213797 CCAGTGATGAAGAGGATTTCTGG - Intronic
1067300869 10:45007961-45007983 ACAGTCATGAAGAGAAGTTCAGG + Intergenic
1068226471 10:54113100-54113122 CCAGGGAAAAAGAGAATTTCCGG + Intronic
1070149073 10:73794453-73794475 TCTGTGATGATGAGGATTTTGGG + Intronic
1071232367 10:83603329-83603351 ACAGTGATGAAAAGGAGTTATGG + Intergenic
1072188754 10:93064293-93064315 CCAGTGCTGAGAAGGTTTTCTGG + Intronic
1072458822 10:95601176-95601198 CCTGTAAGGAAGAGGATCTCTGG + Intergenic
1072800826 10:98391179-98391201 TGAAGGATGAAGAGGATTTCCGG - Intronic
1074635991 10:115318230-115318252 CCAGGGATGAAGTTGACTTCTGG + Intronic
1077548345 11:3186901-3186923 CCAGTGATGAGTGGGATTGCTGG + Intergenic
1078433207 11:11303293-11303315 CCAGTGCTGCTGGGGATTTCTGG - Intronic
1081138807 11:39472657-39472679 TCAGTGAAGATGAGGATTTTGGG + Intergenic
1082238143 11:49844853-49844875 CCAGTCATCAAGAGCAGTTCTGG - Intergenic
1085487394 11:76877571-76877593 CTAGTGATCAATGGGATTTCAGG - Intronic
1086252392 11:84832091-84832113 CCATACATGAAGAGGAATTCTGG + Intronic
1087136303 11:94724009-94724031 CCACTGATGATTAGGATTTTTGG + Intronic
1087600510 11:100309130-100309152 CCAGTCATGGAGAGGAATTAGGG + Intronic
1087648479 11:100835814-100835836 CCAGGGAAGAAGATAATTTCTGG - Intronic
1091111633 11:132974395-132974417 CCAGTGATGATGAGCTTTTTCGG - Intronic
1092036155 12:5336744-5336766 CCAGAGATAAAGGGGATTGCCGG + Intergenic
1092387409 12:8046694-8046716 ACAGTGGTGAAGTTGATTTCAGG + Intronic
1093195342 12:16123932-16123954 CAAGAGATGAAGAGCATCTCTGG + Intergenic
1096894918 12:54812013-54812035 CCTTTGAAGAAGAGGCTTTCTGG + Intergenic
1097631607 12:62071099-62071121 ACAGTGATGAAGAGAATCTGTGG + Intronic
1099110025 12:78547139-78547161 CCAGTGGTGATGAGGCATTCAGG + Intergenic
1099993617 12:89753139-89753161 CCAGTGAAGATGAGGAAGTCTGG + Intergenic
1100693592 12:97065943-97065965 ACAGTGATGAGGAGAATTTGGGG + Intergenic
1100706044 12:97201541-97201563 TCAGAGATGAGAAGGATTTCAGG + Intergenic
1101108548 12:101463134-101463156 CCAGTCCTCAAGAGGAATTCTGG + Intergenic
1101389130 12:104284175-104284197 CCAGGGATGCAAAGGATTGCTGG + Intronic
1101732736 12:107440140-107440162 GCAGTGATGAAGTGGGCTTCAGG - Intronic
1102189590 12:110976888-110976910 CCAGTCATGAAGAGGCTTATGGG + Intergenic
1102831728 12:116008472-116008494 CCAGTGATGATGCTGAGTTCAGG - Exonic
1102834762 12:116045218-116045240 CCAGTGTTCAAAAGGATTTTAGG - Intronic
1102864653 12:116364657-116364679 CCTGTGAGGTAGAGGATTCCAGG + Intergenic
1106459841 13:29959226-29959248 CCAGGGATGAGGTGGATTTTAGG - Intergenic
1106945892 13:34827584-34827606 CTAGTGATGATGAGAATTTGGGG - Intergenic
1108324961 13:49321034-49321056 GCAGTGAGGAGGAGGATTTCAGG - Intronic
1113546435 13:111154242-111154264 CCAGTGAGGAAGAGTGGTTCTGG + Intronic
1113978485 13:114250912-114250934 CCAGTGGAGGAGAGGAGTTCTGG + Intronic
1115860782 14:37683926-37683948 TCAGTGTGGGAGAGGATTTCTGG - Intronic
1116110557 14:40575302-40575324 CCAGTGATGAAGGTGATTAATGG + Intergenic
1116320363 14:43454534-43454556 CCAGTGAGGAAGAGCAGATCAGG - Intergenic
1119644158 14:76336543-76336565 CCAGCCATGAAGAGGGTGTCAGG - Intronic
1120353911 14:83403345-83403367 CCATTGAGGAAGATGATTTCAGG - Intergenic
1120949402 14:90027207-90027229 CCAGTGATGATGAGCATTCCTGG + Intronic
1121836500 14:97097196-97097218 CCAGTGATGGAGAGAATTGGTGG - Intergenic
1122255889 14:100476161-100476183 CCAGGGCTGGAGAGGATTGCTGG + Intronic
1124070188 15:26384494-26384516 CCAGTAATGAATGAGATTTCTGG + Intergenic
1124953701 15:34346045-34346067 CAGGTGGTGAGGAGGATTTCTGG + Intronic
1125965423 15:43871530-43871552 CCAGAGATGAAAAGGCTGTCAGG - Exonic
1128723379 15:69969753-69969775 CCGGTAATGAAAAGGATTGCTGG + Intergenic
1128728784 15:70006699-70006721 CCAGAGCTGAAAAGGATTCCAGG - Intergenic
1129092424 15:73165642-73165664 TCAGTGATGAAGAGAATTAAGGG + Intronic
1129138290 15:73573920-73573942 GCTTTGATGAAGAGCATTTCAGG + Intronic
1133088478 16:3384517-3384539 ACAGGGATGAAAAGGACTTCAGG - Exonic
1134223309 16:12372377-12372399 CCAGAGGGGAAGAGGATTACAGG - Intronic
1134440811 16:14298687-14298709 CCACTGCTGAACTGGATTTCAGG + Intergenic
1137397979 16:48130411-48130433 GAAGTGATGAAGAGGATGTTGGG - Intronic
1138058399 16:53860737-53860759 CCAGTGTTGGAGATGAGTTCTGG - Intronic
1138577052 16:57914739-57914761 CCAGTGATGAAACGGGTGTCTGG + Intronic
1138948291 16:61879502-61879524 CCAGTGTTGAAGCCAATTTCAGG - Intronic
1143151065 17:4807785-4807807 CCAGTGGGGAAGAGGCTCTCAGG - Exonic
1146223406 17:31046237-31046259 CCAGGGACAAAGAGGAGTTCTGG + Intergenic
1146341583 17:32023733-32023755 CCAGGGACAAAGAGGAGTTCTGG - Intronic
1146351218 17:32095890-32095912 CCAGGGACAAAGAGGAGTTCTGG + Intergenic
1150002509 17:61450887-61450909 CCACTGTTGAGGTGGATTTCAGG + Intergenic
1150141030 17:62728648-62728670 CAAGAGATAAGGAGGATTTCTGG + Intronic
1153064040 18:1024709-1024731 CCAATGATGAACAGGACCTCTGG + Intergenic
1153931357 18:9882480-9882502 CCAGAGATGGAGATGAGTTCTGG - Intergenic
1154001447 18:10485597-10485619 CGGGTGAGGAAGAGGACTTCGGG - Exonic
1154392326 18:13949156-13949178 CAAGTGCTGATGAGGATTCCAGG - Intergenic
1157231570 18:45921472-45921494 CTAGTGATGAAGACTATATCTGG - Intronic
1157516365 18:48314664-48314686 CCCTTGTTGAAGGGGATTTCTGG - Intronic
1158742159 18:60155354-60155376 CAAGAGAGAAAGAGGATTTCTGG - Intergenic
1159509650 18:69379785-69379807 CCAGTGATGAATACTATTTGTGG + Intergenic
927619968 2:24644900-24644922 ACATGGATGAAGAGGATTTCTGG - Intronic
928815841 2:35293404-35293426 CCAGTAATGGAAAGGATTTAGGG - Intergenic
929299827 2:40290161-40290183 ACAGTAATGAAGAGGATATGGGG - Intronic
929932495 2:46269710-46269732 CCATTGATGAAGAGTACTTGTGG + Intergenic
930124659 2:47785900-47785922 CCCGTTATGGAGAGGATTCCAGG + Intronic
930364315 2:50420023-50420045 GCAGAGATAAAGAGGATTTGGGG + Intronic
931439933 2:62281938-62281960 CTAGTGTTGAAGATGATTTAGGG + Intergenic
932992166 2:76800906-76800928 CCAGTGATGATGAGCATTGATGG - Intronic
935205322 2:100891825-100891847 ACAGTGAAGATGAGCATTTCTGG + Intronic
939304953 2:140400081-140400103 CAAGTGATGAAGACTTTTTCTGG + Intronic
941177991 2:162222947-162222969 GCATTGACGAAGAGAATTTCTGG - Intronic
941315746 2:163990468-163990490 ACAGAGGTGATGAGGATTTCAGG - Intergenic
944413562 2:199463428-199463450 CGAGTGAGGCAGAGGATCTCAGG + Intronic
945732362 2:213554246-213554268 TCAGTGTTGATGAAGATTTCAGG - Intronic
946295927 2:218783441-218783463 CCAATGTTGGAGAGGATTTAGGG + Intronic
947422324 2:229952248-229952270 CAAGGAATGAAGAGGATTTAAGG - Intronic
949065241 2:241986285-241986307 CCGGGGATGAAGTGGATTTTGGG + Intergenic
1169601609 20:7267316-7267338 CCAGTTATCAAGAGATTTTCAGG + Intergenic
1170908969 20:20544497-20544519 CCAGTAATGAATGGGATTGCTGG - Intronic
1175052013 20:56164433-56164455 CCAGCGATGTAGAGAATTTATGG - Intergenic
1176379682 21:6105913-6105935 TCAGCTATGAAGAGCATTTCCGG + Intergenic
1177992527 21:28055608-28055630 CAAGTGAGGAGGAGAATTTCAGG - Intergenic
1179460855 21:41533972-41533994 TCAGTGACCAGGAGGATTTCTGG + Intergenic
1179743792 21:43432324-43432346 TCAGCTATGAAGAGCATTTCCGG - Intergenic
1180655006 22:17412983-17413005 CCAGTTTTAAAGAGGATGTCAGG - Intronic
1181278495 22:21702419-21702441 CCAGAGATGATCAGGAATTCAGG + Intronic
1184136452 22:42553038-42553060 CAAGTTATGAAGAGGATGTTTGG - Intergenic
1185362882 22:50419637-50419659 CCAGTGATGATGAGGGTCTAAGG - Intronic
949932133 3:9087514-9087536 GAAGTGATGAAGAGGATTAAGGG + Intronic
952581981 3:34845108-34845130 CTAGGAATGAAGATGATTTCTGG - Intergenic
953600643 3:44360419-44360441 CCAGTGATGCACAGGATTTTTGG + Intronic
953998965 3:47541382-47541404 CCTGTAATGCAGGGGATTTCAGG - Intergenic
955186776 3:56721828-56721850 CCAGTCTTGAAAGGGATTTCAGG - Intergenic
955762804 3:62306267-62306289 CCAGTGATGATGAGGTTTGTTGG - Intergenic
958878418 3:99641422-99641444 CTAATGATGAAAATGATTTCAGG + Intronic
959175014 3:102897177-102897199 GGAGAGATGAAGAGGATTACAGG - Intergenic
959930976 3:111981867-111981889 CCAGGGATGAAGATAATTCCTGG - Exonic
964427803 3:156571473-156571495 CCATGGCTGAAGAGGATTTATGG + Intergenic
965240521 3:166191168-166191190 TGAGTGATAAAGAGGAATTCTGG + Intergenic
967201206 3:187074079-187074101 CCACTGATGAAGATGACTCCTGG + Intronic
970589648 4:17548071-17548093 CCAGGGATGAGGTGGATCTCAGG + Intergenic
972228624 4:37043999-37044021 CTAGTGAAGAAGAGGATTCAAGG + Intergenic
974156260 4:58077261-58077283 CCAGAGATGAAGTGGCTTTGTGG + Intergenic
974477182 4:62398412-62398434 CCACTTATGATGAGGATATCTGG + Intergenic
976067333 4:81203833-81203855 CCAGGCAGGAAGAGGATTTCAGG - Intronic
976134832 4:81924447-81924469 TCAGTGATCAAGAGGACTTGAGG - Intronic
979560933 4:122101421-122101443 TCAATATTGAAGAGGATTTCTGG - Intergenic
980649567 4:135695052-135695074 CTAGTGTTGAATAGGATTTTTGG + Intergenic
981636003 4:146879936-146879958 ACAGTGATGATGAAGATTTGTGG - Intronic
982678324 4:158400827-158400849 CCAGTGAGGAACTGGAGTTCAGG + Intronic
982780628 4:159487552-159487574 CCAGTGAAGAACATCATTTCTGG - Intergenic
982808157 4:159791974-159791996 TCAGTTATTAAGAGGATTTAAGG + Intergenic
983601820 4:169539165-169539187 GCATTGGTGAAGTGGATTTCTGG - Intronic
984559397 4:181250890-181250912 CCAGTCATAAAGAGGATATGTGG + Intergenic
985152391 4:186960265-186960287 CGAGTGCTGAAGAGGAACTCCGG + Intergenic
985154577 4:186972968-186972990 CGAGTGCTGAAGAGGAACTCCGG + Intergenic
986583683 5:9292472-9292494 ACAGTAATGAAGAGGGTTTGGGG - Intronic
987721431 5:21638154-21638176 CCATTAATGAAGAAGATTTGGGG - Intergenic
993475876 5:88363167-88363189 CCAGTGATGATGAGCATGTTAGG + Intergenic
994296742 5:98098891-98098913 CCATTGATGAAGAGAATATTTGG + Intergenic
996131940 5:119792161-119792183 GTGGTGATGAGGAGGATTTCTGG + Intergenic
997159935 5:131597217-131597239 CAAGTGTTGGCGAGGATTTCAGG + Intronic
999405344 5:151302278-151302300 CCAGTGTTGATAAGGATATCAGG - Intronic
1004979754 6:21010462-21010484 CAAGTGATGAAATGGATCTCTGG - Intronic
1005587323 6:27289279-27289301 TCAGCCATGGAGAGGATTTCAGG - Intronic
1007597111 6:43058082-43058104 CCAGTGAAGATGAGGAAGTCTGG - Exonic
1007874952 6:45086728-45086750 CCAGTGATGCACAGTTTTTCTGG - Intronic
1008154113 6:47992949-47992971 GCAGTGCTGAAAAGGACTTCAGG + Intronic
1009885936 6:69623990-69624012 CCACTGTTGTAGAGGATTTGAGG + Intergenic
1011752086 6:90463592-90463614 CCAGTGAGGAACAGGATGTGTGG + Intergenic
1012166336 6:95957379-95957401 TCAGTGATGAGGAGAATATCAGG - Intergenic
1012606613 6:101166087-101166109 CCAATCATGAAGAGCATTGCTGG - Intergenic
1013606837 6:111758622-111758644 CCAGTGGAGAACAGGAGTTCAGG - Intronic
1016625745 6:146165996-146166018 ACATTGAGGAAAAGGATTTCTGG + Intronic
1017708913 6:157148375-157148397 GCACTGATGAAGAGAAATTCAGG - Intronic
1017876260 6:158526950-158526972 GCTGTGATGATGAGGTTTTCTGG - Intergenic
1020763798 7:12296704-12296726 CCAGAGATGAATAGAAATTCTGG + Intergenic
1021071065 7:16241818-16241840 CCAGTGATAAAGGAGATTTCAGG - Intronic
1023887201 7:44367757-44367779 TCAGGGATGAAGAGGAGTTGTGG - Intergenic
1028743579 7:94303377-94303399 CCCAGGGTGAAGAGGATTTCTGG - Intergenic
1031410524 7:121435848-121435870 CCAGCGATGAAGAGCAATTAAGG + Intergenic
1032453865 7:132056999-132057021 CCAGTGCTGAAGAGCATTCTTGG + Intergenic
1035488192 7:159246868-159246890 CAAGTGTTGAAGAGGATGTGGGG + Intergenic
1036750610 8:11441504-11441526 CCTGTGATGAGGATGATTTCTGG + Intronic
1037643192 8:20767401-20767423 CCAGGTAAGAAGAGGATTCCTGG - Intergenic
1038084074 8:24174227-24174249 CAATTGATGGAGAGGATTTTTGG - Intergenic
1044186901 8:89264334-89264356 CCAGTGATGGCTAGGAGTTCTGG - Intergenic
1044543427 8:93432825-93432847 CCAGTGTTCAAAAGGACTTCAGG - Intergenic
1044814596 8:96098444-96098466 GCAGAGATGAAGAATATTTCAGG + Intergenic
1047500400 8:125436103-125436125 CCAGTGGTGTTGAGGATCTCAGG - Exonic
1050629795 9:7546304-7546326 GCAGTGAGGAAGAGTGTTTCAGG + Intergenic
1050641030 9:7667755-7667777 CCAGTGATGATGAGCATTACAGG + Intergenic
1053117517 9:35518596-35518618 GCAGGGATGAAGAAGCTTTCAGG + Intronic
1056194607 9:84217469-84217491 CCAGAGATCAGAAGGATTTCTGG - Intergenic
1062046337 9:134426186-134426208 TCAGTGATGCAGAGGATACCAGG - Intronic
1185527321 X:789979-790001 CCAGAGATGAGGAGGATTCTAGG + Intergenic
1189553889 X:42122141-42122163 CCAGTAATAAAGAGAATTACAGG + Intergenic
1189840709 X:45073386-45073408 CCAGTAATGAATGGGATTGCTGG + Intronic
1192442661 X:71186133-71186155 AGAGTGGTGAGGAGGATTTCAGG + Intergenic
1193454027 X:81707234-81707256 GCAGTGATGAATAGGATTTGTGG + Intergenic
1194099591 X:89687368-89687390 CCAGTGCTGAAGATGATATAAGG + Intergenic
1196256215 X:113522136-113522158 CCAGTAATGAATGGGATTGCTGG + Intergenic
1197812512 X:130459593-130459615 CCAGTGGTGATGGGGTTTTCTGG + Intergenic
1198278479 X:135119347-135119369 CCAGTGAGGAAGAGGTTGCCGGG - Intergenic
1198292483 X:135253169-135253191 CCAGTGAGGAAGAGGTTGCCGGG + Intronic
1199329741 X:146544832-146544854 CCAGAGATGAACTGGATTTATGG - Intergenic
1200154542 X:153968467-153968489 CCGGTGAGGAAGAGGGCTTCAGG + Intronic
1200452595 Y:3348748-3348770 CCAGTGCTGAAGATGATATAAGG + Intergenic