ID: 1065297711

View in Genome Browser
Species Human (GRCh38)
Location 10:24292430-24292452
Sequence GGCAAATGGCCTTCCTGTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 92}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065297711_1065297715 25 Left 1065297711 10:24292430-24292452 CCTTTACAGGAAGGCCATTTGCC 0: 1
1: 0
2: 0
3: 9
4: 92
Right 1065297715 10:24292478-24292500 TATTCTGCACAACCATGAAGAGG No data
1065297711_1065297714 0 Left 1065297711 10:24292430-24292452 CCTTTACAGGAAGGCCATTTGCC 0: 1
1: 0
2: 0
3: 9
4: 92
Right 1065297714 10:24292453-24292475 TCACTCATCAGAAGTATTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065297711 Original CRISPR GGCAAATGGCCTTCCTGTAA AGG (reversed) Intronic
900656728 1:3762365-3762387 AGCAAGTGGCCTTGCAGTAAAGG - Intronic
902802751 1:18840436-18840458 GGCAGCTGGTCTTCCTGGAATGG - Exonic
904212375 1:28894543-28894565 GGCAACTGGACTTCCTGGAGAGG + Intronic
906672049 1:47663280-47663302 GGCAAATGGACTTCATCTAAAGG - Intergenic
906690047 1:47786527-47786549 GGCAACTGGCATTCCTGTGAAGG - Intronic
910287746 1:85574364-85574386 TGCGAATGGCCTTGCTGTCATGG - Intronic
916877064 1:168980594-168980616 CTTAAATGCCCTTCCTGTAATGG - Intergenic
919934928 1:202245178-202245200 GGCAGATGGCCTCCCTGGCATGG + Intronic
922537740 1:226394445-226394467 GCCAAATTGCCTTCCAGAAAAGG - Intronic
1065297711 10:24292430-24292452 GGCAAATGGCCTTCCTGTAAAGG - Intronic
1067947156 10:50696781-50696803 GGCAGATGCCCTTGCTGTGATGG - Intergenic
1070882465 10:79861769-79861791 GGCAGATGCCCTTGCTGTGATGG - Intergenic
1071649037 10:87378080-87378102 GGCAGATGCCCTTGCTGTGATGG - Intergenic
1075954936 10:126515384-126515406 AGAAAATGGCCTACCTGTATAGG - Intronic
1076924495 10:133475632-133475654 GGCAAATGGGGCTCCTGTGATGG + Intergenic
1079249736 11:18778719-18778741 GGCACATGGCCAGCCTGTACAGG - Intronic
1079920297 11:26425340-26425362 GGCAAATGGGAATCCTGAAAAGG - Intronic
1080243022 11:30148788-30148810 AGCAAATGGGCATCCTGAAAGGG - Intergenic
1080434002 11:32223344-32223366 GGCAGATGACCTTCCTGTGGAGG - Intergenic
1084449829 11:69229928-69229950 GGCAAAAGGCCTACCTGACATGG + Intergenic
1084744864 11:71163327-71163349 GGCACAGGGTCTGCCTGTAATGG + Intronic
1086419099 11:86620305-86620327 GGCAATTTGCCTTCATGAAATGG + Intronic
1088480070 11:110288065-110288087 TGTAAATGGATTTCCTGTAAGGG + Intronic
1089583078 11:119493673-119493695 GGAAAATGGTCATCTTGTAAAGG + Intergenic
1099823515 12:87746021-87746043 GTCAAAAGGGCTTTCTGTAAGGG + Intergenic
1100460393 12:94793667-94793689 ACCAAATGGTCTCCCTGTAATGG + Intergenic
1101986395 12:109450736-109450758 GTCAGATGGCCTTCCTGGAGTGG + Exonic
1107177495 13:37416084-37416106 AGCAAAAAGCCTTCCTGGAAAGG - Intergenic
1113602856 13:111582991-111583013 AGCAAATGGCTCTCCTGGAAAGG + Intergenic
1117107240 14:52410313-52410335 TGGAAATGGCCTTCCAGAAATGG - Intergenic
1117573622 14:57074710-57074732 TGCAAATGTCCTTCCTTAAAGGG + Intergenic
1118795245 14:69137702-69137724 GGCAAAGGGGCTTACTGTACTGG - Intronic
1121208462 14:92188555-92188577 GGCATATGCGCTTCCTGGAATGG - Intergenic
1124341782 15:28894543-28894565 GGCAAAGGGCCAGCCTGGAATGG + Intronic
1130431292 15:83849671-83849693 GACAAATGGCCTCCTGGTAAAGG - Intronic
1131076666 15:89499511-89499533 GGCAAACGGCCTTCTTGTGCTGG - Intergenic
1134206114 16:12239125-12239147 GGCACATGGCCTTTCTGAATAGG + Intronic
1137848083 16:51711590-51711612 GGAAAATGGCCTTCATGGGAAGG + Intergenic
1138845186 16:60556414-60556436 GGAAAATGGGCTTCATGCAATGG - Intergenic
1144211998 17:13023578-13023600 TGCAAATGGCCTTCCTCTTGCGG + Intergenic
1148515566 17:48213726-48213748 GGCAAATATCATTCCTGTTATGG - Intronic
1149453176 17:56766112-56766134 GGCAAATGAGCTCCCTTTAAAGG - Intergenic
1153014756 18:573546-573568 GCCAAATGGGCTGCCTGTGAAGG - Intergenic
1158665776 18:59431418-59431440 GTCAAATAACCTTCCTGAAAAGG - Exonic
927177863 2:20422792-20422814 TGCAGATGGCCTTCCTGTGCAGG - Intergenic
929124292 2:38509157-38509179 GAGAAATGGCCTTTCTCTAAGGG - Intergenic
933683091 2:85120193-85120215 AGCAAATGGCTTTCCTGTGAGGG - Intergenic
937590257 2:123604974-123604996 CGCTAATGGCCTTGCTTTAATGG + Intergenic
938114546 2:128594427-128594449 GACCAAAGGCCTTCCTGGAAGGG - Intergenic
940228080 2:151421391-151421413 GGCAAAAGGCCCTGCTCTAATGG + Intronic
940752912 2:157647332-157647354 GGCAAATTCCCATCCTTTAATGG - Intergenic
943337918 2:186641677-186641699 AGCAAATCTCCTTCCTGGAAAGG + Intronic
944381716 2:199118154-199118176 GGGAAATGGTCTTCTTGTATAGG - Intergenic
946099829 2:217310533-217310555 GGCAAATTGAGTTTCTGTAATGG + Intronic
1169935365 20:10877836-10877858 GGCAATTGGACTTTCTGTCAGGG + Intergenic
1171402115 20:24880477-24880499 GGCACAGGGCCTTTCTTTAAGGG + Intergenic
1181885539 22:26019213-26019235 GGCAAATGGGCTTGCTGAGAAGG - Intronic
1181937314 22:26448189-26448211 GGCAAATGGCCTCCCAGCACAGG - Intronic
1185078685 22:48697006-48697028 GGCAAAAGGGCTTCCTTGAAGGG + Intronic
953849173 3:46452787-46452809 GGTAAATTGCCTCACTGTAAAGG + Intronic
963182961 3:142379707-142379729 GACAAATGGCCTTTCTGCAAAGG - Intronic
963852217 3:150220323-150220345 GGCAAATGGCCTTGGCGTTAGGG - Intergenic
967108263 3:186271160-186271182 GGCACTTAGCCTTCCTGAAAAGG - Intronic
967267930 3:187707438-187707460 GCCAATTGGTCATCCTGTAAGGG - Intronic
967373943 3:188780369-188780391 AGCAAATGGAATTCCTTTAAGGG + Intronic
972161974 4:36238128-36238150 GGGAACTGGGCTTCCTGTAAGGG - Intronic
980119985 4:128717860-128717882 GGCAAATGGCCCTCTTCTCAGGG + Intergenic
980183181 4:129427486-129427508 GGTAAATGCTCTTCCTGTGAAGG + Intergenic
983632295 4:169861363-169861385 GGCACTTATCCTTCCTGTAAAGG - Intergenic
983841983 4:172468487-172468509 GTAAATTGTCCTTCCTGTAAGGG + Intronic
991043004 5:62194787-62194809 GGCAGATGGCCTTCCTCTTGTGG + Intergenic
994106494 5:95955282-95955304 GCCAAATGCCCTTTCTGTAGAGG + Intronic
994502556 5:100598449-100598471 GGCAAATGGAGTTCATCTAAAGG - Intergenic
996466930 5:123813722-123813744 TGCAAATGGCATGCTTGTAAGGG + Intergenic
998365194 5:141625967-141625989 TGAGAATGGCCTTCCTGTTATGG + Intronic
999501716 5:152153314-152153336 GACAAATGGACTTACTGTGAAGG + Intergenic
1000560723 5:162785543-162785565 GGCATATCACCTTCCTGTAATGG - Intergenic
1002212144 5:177605373-177605395 GGCAGAGGGCCTTCCTGGCAGGG - Intronic
1005758211 6:28944305-28944327 TGCGAAAGGCCTTCCTGTACGGG - Exonic
1006996594 6:38266978-38267000 GGCAGATGGCCTTGCTGGAGAGG - Intronic
1010975165 6:82303872-82303894 AGGAAATGGCCTTCCTGAAAAGG - Intergenic
1015654537 6:135502439-135502461 GGTAAATGCACATCCTGTAAGGG - Intergenic
1017552220 6:155521300-155521322 GGCAATGGGCTTTTCTGTAAGGG - Intergenic
1020209821 7:6150281-6150303 GGCAAACGGTCTTCCTGGAAAGG + Exonic
1020405469 7:7828605-7828627 GGCTAAGGGGCTGCCTGTAAAGG + Intronic
1022997489 7:35772294-35772316 GAAAGATGGCCTTCTTGTAAAGG + Intergenic
1028617164 7:92781467-92781489 GGCAAGTTGCCTTCATCTAATGG + Intronic
1028726203 7:94090658-94090680 GGGAAATGGCCTGCCTGAAAGGG - Intergenic
1038489228 8:27957878-27957900 GGCAAATGGTTTTCTTGTGAAGG + Intronic
1040447630 8:47511692-47511714 GGCAAATGGTCTTGGTGTACTGG + Intronic
1043962465 8:86432930-86432952 TGCAAGTAGCTTTCCTGTAAAGG - Intronic
1046240220 8:111479992-111480014 GTTAAATGGGCTTCCTGAAAAGG - Intergenic
1046392058 8:113587508-113587530 CTCCAATGTCCTTCCTGTAAGGG - Intergenic
1048062787 8:130937672-130937694 TGCAAATGTCCTTGCTGGAAAGG - Intronic
1048338652 8:133522297-133522319 TGCAAATGGCTTCCCTGGAATGG + Intronic
1049005658 8:139854021-139854043 GGCAAATGGTCTCACTGAAAGGG + Intronic
1056986944 9:91372000-91372022 GGCAAATTGCCTTCCTTAACAGG - Intergenic
1189824577 X:44904570-44904592 AACAAATGGCCTTCAAGTAAAGG + Intronic
1189858370 X:45247312-45247334 GGCCAATGTCCTTCCTATCAGGG + Intergenic
1190049990 X:47142367-47142389 GGCCAATGGCCTTCCCATCATGG - Exonic
1196921961 X:120594108-120594130 GCCAAATGGCCTTCCTCTCCTGG - Intronic
1201148494 Y:11080956-11080978 GGCACAGGGTCTGCCTGTAATGG + Intergenic