ID: 1065297711

View in Genome Browser
Species Human (GRCh38)
Location 10:24292430-24292452
Sequence GGCAAATGGCCTTCCTGTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065297711_1065297714 0 Left 1065297711 10:24292430-24292452 CCTTTACAGGAAGGCCATTTGCC No data
Right 1065297714 10:24292453-24292475 TCACTCATCAGAAGTATTAGAGG No data
1065297711_1065297715 25 Left 1065297711 10:24292430-24292452 CCTTTACAGGAAGGCCATTTGCC No data
Right 1065297715 10:24292478-24292500 TATTCTGCACAACCATGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065297711 Original CRISPR GGCAAATGGCCTTCCTGTAA AGG (reversed) Intronic