ID: 1065297715

View in Genome Browser
Species Human (GRCh38)
Location 10:24292478-24292500
Sequence TATTCTGCACAACCATGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065297713_1065297715 4 Left 1065297713 10:24292451-24292473 CCTCACTCATCAGAAGTATTAGA 0: 1
1: 0
2: 0
3: 10
4: 127
Right 1065297715 10:24292478-24292500 TATTCTGCACAACCATGAAGAGG No data
1065297711_1065297715 25 Left 1065297711 10:24292430-24292452 CCTTTACAGGAAGGCCATTTGCC 0: 1
1: 0
2: 0
3: 9
4: 92
Right 1065297715 10:24292478-24292500 TATTCTGCACAACCATGAAGAGG No data
1065297712_1065297715 11 Left 1065297712 10:24292444-24292466 CCATTTGCCTCACTCATCAGAAG 0: 1
1: 0
2: 0
3: 23
4: 192
Right 1065297715 10:24292478-24292500 TATTCTGCACAACCATGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065297715 Original CRISPR TATTCTGCACAACCATGAAG AGG Intronic
No off target data available for this crispr