ID: 1065299742

View in Genome Browser
Species Human (GRCh38)
Location 10:24310648-24310670
Sequence TTAGAGGCACACCTGGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 193}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065299742_1065299751 23 Left 1065299742 10:24310648-24310670 CCTTGCTCCAGGTGTGCCTCTAA 0: 1
1: 0
2: 0
3: 22
4: 193
Right 1065299751 10:24310694-24310716 GGGCACATATAATTGAATATAGG No data
1065299742_1065299745 -2 Left 1065299742 10:24310648-24310670 CCTTGCTCCAGGTGTGCCTCTAA 0: 1
1: 0
2: 0
3: 22
4: 193
Right 1065299745 10:24310669-24310691 AACACTCAGTCCCTTTTCCAAGG No data
1065299742_1065299753 28 Left 1065299742 10:24310648-24310670 CCTTGCTCCAGGTGTGCCTCTAA 0: 1
1: 0
2: 0
3: 22
4: 193
Right 1065299753 10:24310699-24310721 CATATAATTGAATATAGGCTGGG No data
1065299742_1065299747 3 Left 1065299742 10:24310648-24310670 CCTTGCTCCAGGTGTGCCTCTAA 0: 1
1: 0
2: 0
3: 22
4: 193
Right 1065299747 10:24310674-24310696 TCAGTCCCTTTTCCAAGGCAGGG No data
1065299742_1065299746 2 Left 1065299742 10:24310648-24310670 CCTTGCTCCAGGTGTGCCTCTAA 0: 1
1: 0
2: 0
3: 22
4: 193
Right 1065299746 10:24310673-24310695 CTCAGTCCCTTTTCCAAGGCAGG No data
1065299742_1065299752 27 Left 1065299742 10:24310648-24310670 CCTTGCTCCAGGTGTGCCTCTAA 0: 1
1: 0
2: 0
3: 22
4: 193
Right 1065299752 10:24310698-24310720 ACATATAATTGAATATAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065299742 Original CRISPR TTAGAGGCACACCTGGAGCA AGG (reversed) Intronic
902700345 1:18167936-18167958 TTTGTGGCGCACGTGGAGCAGGG - Intronic
903943908 1:26950069-26950091 TTAGCAGTACACCTGGAGCAAGG + Exonic
907053440 1:51344882-51344904 TGAGAGGCACAGCTGGGGAAAGG - Intronic
907856867 1:58312157-58312179 TTAGAGCCACACACCGAGCAGGG - Intronic
909786280 1:79617877-79617899 TTAAAGGCATTCCTGGAACAGGG + Intergenic
910369751 1:86503319-86503341 TTGGAGGCACCCCTCCAGCAGGG - Intergenic
910989369 1:93039127-93039149 TTTGAGTCACAACTGGAGGATGG + Intergenic
911361815 1:96885982-96886004 CTAGAGAAAAACCTGGAGCAGGG - Intergenic
911903162 1:103530426-103530448 TTAGAGGAACAGCTGGAACAGGG + Intronic
920411047 1:205761194-205761216 TTAGAGGATCACCTGAAGCCAGG + Intergenic
921049763 1:211502639-211502661 TTAGAGTCATTCCTGGAACAGGG + Intergenic
921290712 1:213654562-213654584 TTTGAGACATTCCTGGAGCATGG - Intergenic
922084060 1:222328625-222328647 TTAGAGGCACCACTGGAGTGTGG - Intergenic
923859838 1:237882538-237882560 CTACAGGAACACCTGGAGGATGG + Exonic
1063207492 10:3847859-3847881 TTAGAGCTACACCTTAAGCATGG + Intergenic
1064596706 10:16952969-16952991 ATAGAGGCTCAGCTGGAGCATGG + Intronic
1065299742 10:24310648-24310670 TTAGAGGCACACCTGGAGCAAGG - Intronic
1067067540 10:43112316-43112338 CCAGAAGCAGACCTGGAGCAGGG - Intronic
1067753198 10:48985362-48985384 TTAGAGGCATCCATGAAGCAGGG + Intergenic
1068699061 10:60000916-60000938 TTAGAGGCATTCCTGGAACTAGG - Intergenic
1070647367 10:78211171-78211193 GTAGAGGCACCCCTGGAGGGAGG + Intergenic
1073739964 10:106395184-106395206 TTAGATGAAGCCCTGGAGCATGG - Intergenic
1077163426 11:1124086-1124108 TCATAGGCAACCCTGGAGCATGG + Intergenic
1078087909 11:8245255-8245277 TTAGAGACACATCTGAGGCAAGG + Intronic
1078155138 11:8793352-8793374 TTAGAGGTAAACCAGGAGCTTGG - Intronic
1078639658 11:13082905-13082927 ATACAGGGAGACCTGGAGCAAGG + Intergenic
1079093726 11:17497737-17497759 TTAGACACCCACCTGGATCACGG - Intronic
1079300528 11:19275243-19275265 TTCGAGGTACACCTGGTCCAGGG - Intergenic
1079428339 11:20364340-20364362 TTAAAGGAAATCCTGGAGCAGGG + Exonic
1082781947 11:57294766-57294788 TTAGAGGAACAAATGGAGCCTGG - Intergenic
1084413121 11:69015304-69015326 CCAGCGGGACACCTGGAGCAGGG - Intergenic
1085045090 11:73347982-73348004 GGAGAAGCACAACTGGAGCAAGG + Intronic
1087470568 11:98568779-98568801 TTAGAAACACACCTGCAGCTGGG - Intergenic
1088149142 11:106723194-106723216 TTATACGCAGACATGGAGCAGGG - Intronic
1090317206 11:125803586-125803608 ATTGGGGCAAACCTGGAGCATGG + Intergenic
1090347964 11:126086187-126086209 CTAGAAGCAGACCTGGAGAAAGG + Intergenic
1090394327 11:126408734-126408756 TCACAGACACGCCTGGAGCATGG - Intronic
1092326848 12:7541799-7541821 TGAGAGGAACACCTGGTGAAGGG + Intergenic
1092406212 12:8223715-8223737 CTAGAGGGCCACCTGGAGGATGG - Intronic
1095158634 12:38889481-38889503 TTAGAGGCAAAAGTGGAGAAGGG + Intronic
1095672653 12:44877944-44877966 TTAGATGCACAGCTGTAGAAAGG - Intronic
1096697474 12:53359137-53359159 TTAGAGGCATTCCTGGAGCTGGG + Intergenic
1098402800 12:70091581-70091603 TCAGAGGCATTCCTGGAACAAGG + Intergenic
1099392425 12:82097781-82097803 TTAGAGGAAGACCTTGAGGAGGG + Intergenic
1101303981 12:103509049-103509071 TTAGCTGCACACCTTGAGCAAGG - Intergenic
1102908869 12:116697421-116697443 TCAAGGACACACCTGGAGCAGGG - Intergenic
1104716775 12:131020772-131020794 TGAGAGCCACACCTAGAGGAGGG - Intronic
1110544433 13:76740328-76740350 TTAGAGGTATCCCTGGTGCAAGG - Intergenic
1110869377 13:80432423-80432445 TTAGAGGCATAAGTGGGGCAGGG - Intergenic
1112385755 13:98938303-98938325 TTAGAGGCAGAGCTGGGGTAAGG - Intronic
1113069947 13:106410573-106410595 TGATAGGCACAGCTGGACCAGGG + Intergenic
1116804878 14:49483823-49483845 AGAGAGCCACACCTGGATCAAGG + Intergenic
1119150087 14:72350956-72350978 TTAGAGGCAAAGTTAGAGCACGG - Intronic
1121484849 14:94306610-94306632 TTAGTGGCACAGCTGGAGCCAGG - Intronic
1122059025 14:99124424-99124446 TTAGAGGCAGAAGTGGAGAAGGG - Intergenic
1124090528 15:26595707-26595729 TTAGAGGCATTCCTGGAACAGGG - Intronic
1127332502 15:57952663-57952685 TTAGAGGAACAGAAGGAGCATGG - Intergenic
1128727317 15:69997828-69997850 TTAGAGGCTTTCCTGGAGCTGGG + Intergenic
1129276365 15:74448352-74448374 TTCTAGGAACAGCTGGAGCATGG - Intronic
1130708901 15:86260137-86260159 TTGGAGGCACAGCAAGAGCAAGG + Intronic
1132346637 15:101112682-101112704 TCACAGGGACACCTGGAGCAAGG + Intergenic
1134072833 16:11271561-11271583 TTAGAGGGACAGCTGCAGCAGGG + Intronic
1134233744 16:12449606-12449628 GGAGATGCACAGCTGGAGCACGG - Intronic
1135636056 16:24076672-24076694 TTAAAGGCACACTTGTAGCAAGG - Intronic
1136073407 16:27802485-27802507 TAAAAGGTACACCTGGCGCAGGG + Intronic
1136617356 16:31406632-31406654 TTGGAGGCACCCATGGAGGAAGG - Intronic
1137879886 16:52034996-52035018 TTGGAGGTACAGCTGGAACAGGG - Intronic
1139645696 16:68328170-68328192 TTAGAGGCATTCCTGAAGCTGGG - Intronic
1143537802 17:7551568-7551590 GAAGAGGCACACCGGGAGCAGGG - Intronic
1143805803 17:9425459-9425481 AAAGAGGTACACCTGAAGCAAGG + Intronic
1144392743 17:14811098-14811120 TTAGTGGGAGGCCTGGAGCATGG + Intergenic
1144463894 17:15481199-15481221 TTAGACACACAGCTAGAGCATGG + Intronic
1144517440 17:15928435-15928457 TTCCAGGCACACATGGAGCAGGG + Intergenic
1146744456 17:35314980-35315002 AGAGAGGCAGAGCTGGAGCAGGG - Intergenic
1147389202 17:40099135-40099157 CGAGAGGCACACGTGGAGCAGGG - Intronic
1148042548 17:44720235-44720257 TTAGAGGCACATCTTCAGTAGGG + Intronic
1148633541 17:49130321-49130343 TTAGAGGCACTCCTGGGACTTGG - Intergenic
1148766072 17:50039044-50039066 TGAGAAACACACCTGGAGCTTGG - Intergenic
1151326632 17:73383742-73383764 GGAGAGGCACACATGGAGGAGGG + Intronic
1151974121 17:77474869-77474891 TTAGAGTAACACCTGGGGCTCGG + Intronic
1157602296 18:48901764-48901786 TGAGATGCAGACCTGGAGCCTGG + Intergenic
1158407781 18:57175662-57175684 TTAAATGCAGAGCTGGAGCAAGG - Intergenic
1163332106 19:16646216-16646238 TTGGAGGTAAACCTGGAGGAAGG - Exonic
1166467607 19:43046710-43046732 TAAAAGGCACAGCTGGAGGATGG - Intronic
1166474227 19:43107499-43107521 TAAAAGGCACAGCTGGAGGATGG - Intronic
1166559010 19:43719706-43719728 GTTGAGGCAGCCCTGGAGCATGG - Exonic
1167193738 19:48011831-48011853 TTAGAAGAGTACCTGGAGCATGG - Intronic
1168413775 19:56156320-56156342 TGAGAGGCATAACTGAAGCATGG + Intronic
925621038 2:5793154-5793176 TCACAGGCACTCCTGGAACATGG + Intergenic
927789583 2:25999955-25999977 TTAGAACCACACTTGGAGGAAGG + Intergenic
928416348 2:31095286-31095308 TTGGTAGCACAACTGGAGCAAGG - Intronic
928870231 2:35967088-35967110 TTAGAGGTACTCCTGGAACTGGG + Intergenic
928997353 2:37307114-37307136 TTGGATGCACAACTGGAGCAGGG - Intronic
930379299 2:50607366-50607388 TTAGAGGCACCCATGAAGTACGG - Intronic
931004066 2:57828068-57828090 TTCCAGGCACCCCTGGAGTATGG - Intergenic
931839352 2:66132167-66132189 CAGGAGGCAGACCTGGAGCATGG + Intergenic
932399332 2:71468932-71468954 TCCCAGGCACACCTGGAGGATGG - Intronic
934487420 2:94728779-94728801 TTAGAGGCAGAACTGCAGCCAGG - Intergenic
936590260 2:113796868-113796890 TTAGAGGCATTCCTGGAACAGGG - Intergenic
937258198 2:120569351-120569373 TTAGTGGCACACCTGGGCCTGGG + Intergenic
941321531 2:164061511-164061533 TTACAGTCACACTTGGAGCTTGG - Intergenic
944123554 2:196267933-196267955 TTATATTCATACCTGGAGCAAGG - Intronic
945177840 2:207061655-207061677 TTAAAGGAAAACCTGGAGGAGGG + Intergenic
946862738 2:224015310-224015332 GCAGAGGCACACCTGGGCCAGGG + Intronic
947365824 2:229394135-229394157 TTAGAGGCATTCCTGGAACTGGG - Intronic
1168803888 20:661910-661932 CTGGAGGCACCCCTGCAGCAGGG - Exonic
1169660077 20:7968897-7968919 TTAGAGGCTCACCTTGCTCAAGG + Intergenic
1170661723 20:18348143-18348165 TTCGAGACAAACCTGCAGCAGGG - Intergenic
1171055637 20:21903808-21903830 TAAGAGGCACACCTGTATAAAGG - Intergenic
1171299266 20:24045480-24045502 TTAGAGGCAAAGCTGGAAAAGGG - Intergenic
1173314542 20:41931441-41931463 TTTGAGCCACAGCTGGAGCTGGG + Intergenic
1173829841 20:46075348-46075370 TTTGTGGCCCACCTAGAGCAAGG + Intronic
1174657870 20:52186815-52186837 TCACAGGTACAGCTGGAGCATGG - Exonic
1182991376 22:34771147-34771169 GAAGGGGCACACCTGGGGCAAGG + Intergenic
1183698662 22:39437645-39437667 TTGGCGGCACACCTGGTGCCTGG - Intergenic
1184078232 22:42197661-42197683 TTAGGGGCACCCCTGAAGAAAGG + Intronic
949960149 3:9305162-9305184 TTGGTGGCAGACCTGCAGCAGGG - Intronic
951688420 3:25370602-25370624 GTAGAGGCAGGCCTGGAGAATGG + Intronic
952012448 3:28915966-28915988 TCAGAGGGATACATGGAGCAGGG + Intergenic
959896632 3:111614176-111614198 TTAGAGCCACACTTGGGGGAAGG - Intronic
963272931 3:143303166-143303188 AGAGAGGCCCACCTGGATCATGG + Intronic
967051773 3:185791589-185791611 TGTGATGCACACCTGGAGGAAGG - Intronic
967730679 3:192904110-192904132 TTAAAACCACACCTGGAACACGG + Intronic
968970167 4:3789613-3789635 TTAGAAGAACACGTGAAGCAGGG - Intergenic
969623763 4:8292240-8292262 TTAGAGGCAGATCTGGAGAAGGG + Intronic
969759921 4:9174268-9174290 CTAGAGGGCCACCTGGAGGATGG + Intronic
972128411 4:35800427-35800449 AAAGAGGCACACCTGCACCAGGG + Intergenic
973723717 4:53751126-53751148 GCAGGGGCACACCTGGAGTATGG + Intronic
976000799 4:80371166-80371188 TTTGAGCCACAGCTGGAGCTGGG + Intronic
977751343 4:100613547-100613569 TTTGAGGCAGACCTGGATCCTGG + Intronic
978410019 4:108416177-108416199 TTAGAGGCAGATCTGCATCAGGG + Intergenic
981841159 4:149113940-149113962 TTGGAGGCAGAGCTGGAGGATGG + Intergenic
986029350 5:3880874-3880896 ACAGAGGCACAGCTGGAGCTCGG + Intergenic
986290811 5:6397341-6397363 TTACAGGGACACATGGGGCAGGG + Intergenic
990839439 5:60060446-60060468 TTAGAGGCATTCCTGGAACTGGG - Intronic
993652499 5:90539091-90539113 TTAGAGGCATTCCTGGAACTGGG + Intronic
994674691 5:102805557-102805579 TTAGAAACGGACCTGGAGCAGGG - Intronic
996302701 5:122007727-122007749 TCAGAGGCCAACCTGGAGCGTGG + Intronic
996318990 5:122192697-122192719 TCAGAGGAACAGCTGGAGCAGGG + Intergenic
996472591 5:123877707-123877729 TTGGAGGCAGCCCAGGAGCAGGG - Intergenic
996671323 5:126121411-126121433 TAAGAGGCACAGGTGGATCAAGG - Intergenic
1006442833 6:34062793-34062815 TGAGAGGCACATCTGGGGCTGGG - Intronic
1008009187 6:46445148-46445170 ATAGAGGCTGACCTGGTGCAGGG - Intronic
1015081332 6:129228789-129228811 TTAGAGCCACAGCTGGAGAAAGG - Intronic
1015483839 6:133745967-133745989 TTGGTGACTCACCTGGAGCAGGG + Intergenic
1015955447 6:138593299-138593321 TCAGAGCCAGACCTGAAGCATGG - Intronic
1016226377 6:141744245-141744267 TTACAGCCACACTTGGATCAGGG - Intergenic
1017026284 6:150184244-150184266 TTTAAGGCACAAATGGAGCATGG + Intronic
1017375630 6:153764496-153764518 TTAGAGGCTCAGAAGGAGCAGGG + Intergenic
1017522050 6:155211117-155211139 TTAAAGGCTCACATGGAGAAAGG - Intronic
1018784985 6:167101032-167101054 TTAGAGGCCTTCCTGGAACAGGG + Intergenic
1018963605 6:168466414-168466436 CTAGAGGAGCCCCTGGAGCAGGG - Intronic
1022969597 7:35505080-35505102 TCAAAGGGACACCTGGAGCAAGG - Intergenic
1025749988 7:64285258-64285280 TCAGAGTCACACCTGCAGTAAGG + Intergenic
1026435010 7:70388779-70388801 TTAGGGGCAGACCTGGACAAGGG + Intronic
1026613733 7:71883618-71883640 TTAGAGGCATTCCAGGAACAGGG - Intronic
1027395317 7:77747481-77747503 TTTGAGCCACAGCTGGAGCTGGG - Intronic
1029002178 7:97165991-97166013 ATAGAGGCAAACCTGGGGCAGGG + Intronic
1029199195 7:98827310-98827332 GTTGAGGGCCACCTGGAGCAGGG - Intergenic
1030385614 7:108864324-108864346 TCAGAGGCACACCTGGTCCGTGG + Intergenic
1031390721 7:121211291-121211313 TAAAAGGAACACCTGGGGCAAGG + Intronic
1032873930 7:136017046-136017068 TTACAGGTTCACCTGGAACATGG - Intergenic
1035532236 8:361912-361934 GCAGAGGCTCACATGGAGCACGG - Intergenic
1036263525 8:7257999-7258021 CTAGAGGGCCACCTGGAGGATGG + Intergenic
1036264826 8:7265621-7265643 CTAGAGGGCCACCTGGAGGATGG + Intergenic
1036266127 8:7273243-7273265 CTAGAGGGCCACCTGGAGGATGG + Intergenic
1036267428 8:7280865-7280887 CTAGAGGGCCACCTGGAGGATGG + Intergenic
1036268730 8:7288487-7288509 CTAGAGGGCCACCTGGAGGATGG + Intergenic
1036270034 8:7296109-7296131 CTAGAGGGCCACCTGGAGGATGG + Intergenic
1036297862 8:7550946-7550968 CTAGAGGGCCACCTGGAGGATGG - Intergenic
1036299166 8:7558594-7558616 CTAGAGGGCCACCTGGAGGATGG - Intergenic
1036300471 8:7566244-7566266 CTAGAGGGCCACCTGGAGGATGG - Intergenic
1036301774 8:7573888-7573910 CTAGAGGGCCACCTGGAGGATGG - Intergenic
1036303071 8:7581537-7581559 CTAGAGGGCCACCTGGAGGATGG - Intergenic
1036315566 8:7716538-7716560 CTAGAGGGCCACCTGGAGGATGG + Intergenic
1036316874 8:7724186-7724208 CTAGAGGGCCACCTGGAGGATGG + Intergenic
1036318181 8:7731834-7731856 CTAGAGGGCCACCTGGAGGATGG + Intergenic
1036319490 8:7739482-7739504 CTAGAGGGCCACCTGGAGGATGG + Intergenic
1036320797 8:7747129-7747151 CTAGAGGGCCACCTGGAGGATGG + Intergenic
1036322107 8:7754777-7754799 CTAGAGGGCCACCTGGAGGATGG + Intergenic
1036323416 8:7762425-7762447 CTAGAGGGCCACCTGGAGGATGG + Intergenic
1036324711 8:7770072-7770094 CTAGAGGGCCACCTGGAGGATGG + Intergenic
1036351323 8:8014235-8014257 CTAGAGGGCCACCTGGAGGATGG - Intergenic
1036352628 8:8021881-8021903 CTAGAGGGCCACCTGGAGGATGG - Intergenic
1036353920 8:8029529-8029551 CTAGAGGGCCACCTGGAGGATGG - Intergenic
1036846586 8:12174654-12174676 CTAGAGGGCCACCTGGAGGATGG - Intergenic
1036867948 8:12416973-12416995 CTAGAGGGCCACCTGGAGGATGG - Intergenic
1038333865 8:26630849-26630871 TTAAAGCCACACCTGGACCTGGG + Intronic
1038495584 8:27999780-27999802 TTAGAGGCATTCCTGGAACTGGG - Intergenic
1039368969 8:36965488-36965510 ACAGAGGCAAACCTGGAGCCTGG - Intergenic
1041022299 8:53650086-53650108 TTGGAGACAGACCAGGAGCAGGG + Intergenic
1041408253 8:57525640-57525662 TTAGAGGCAGTTTTGGAGCAGGG + Intergenic
1041740437 8:61151629-61151651 TGAAAGGCACACCTGGGGCCCGG - Intronic
1042274948 8:66994421-66994443 TTAAAGGAACACATGTAGCAAGG - Intronic
1042863215 8:73334227-73334249 TTAGAGGCATTCCTGGAACTGGG - Intergenic
1043626757 8:82271396-82271418 TAAGAGGCACAGGTGAAGCAAGG + Intergenic
1045102325 8:98857902-98857924 TTAGAAGCAAAACTGGAGAAAGG + Intronic
1048608151 8:135991503-135991525 CTAAAGGCACACCTGGCCCAGGG - Intergenic
1051675348 9:19553091-19553113 TGAGAGGTACCCCAGGAGCAAGG + Intronic
1053492690 9:38522140-38522162 TTACAGGCATACTTGGAACAAGG + Intergenic
1053670385 9:40355651-40355673 TTAGAGGCAGAACTGCAGCCAGG + Intergenic
1053920175 9:42981914-42981936 TTAGAGGCAGAACTGCAGCCAGG + Intergenic
1054381504 9:64495635-64495657 TTAGAGGCAGAACTGCAGCCAGG + Intergenic
1054514228 9:66020649-66020671 TTAGAGGCAGAACTGCAGCCAGG - Intergenic
1054805707 9:69394138-69394160 TTAGATGGACACCAGGAGCAAGG + Intergenic
1056065710 9:82932229-82932251 GGAGGGGCACACCTGGAGTATGG + Intergenic
1056591491 9:87969013-87969035 TGAGAGGCACACCTGCTCCAAGG + Intronic
1058847460 9:108975273-108975295 TTTGAGGCATGCCTGGAGGAGGG - Intronic
1059817898 9:117938502-117938524 CTAGAGGCACACCTGAGGCCTGG - Intergenic
1061934562 9:133850189-133850211 TGAGGGTCACACCAGGAGCAAGG + Intronic
1062135973 9:134928760-134928782 TTAGAGTGACACCTAGAGCCAGG + Intergenic
1185825549 X:3245704-3245726 TTAGAGGCATGCCTGGAACTAGG + Intergenic
1189023386 X:37365896-37365918 ATACAGGCACCCCTGAAGCAGGG - Intronic
1190573970 X:51814383-51814405 TTAGTGGCACCCCTGTAGCATGG + Intronic
1192018220 X:67355186-67355208 TGAGAGTCACACTTTGAGCATGG + Intergenic
1200070446 X:153526424-153526446 CTTCAGGCACTCCTGGAGCACGG + Intronic