ID: 1065307084

View in Genome Browser
Species Human (GRCh38)
Location 10:24379529-24379551
Sequence CTCTCAGGACCTTCCCATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 126}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065307084_1065307092 30 Left 1065307084 10:24379529-24379551 CCTCTATGGGAAGGTCCTGAGAG 0: 1
1: 0
2: 0
3: 8
4: 126
Right 1065307092 10:24379582-24379604 TGCAATTGGTTCTGTTGAGAGGG No data
1065307084_1065307089 3 Left 1065307084 10:24379529-24379551 CCTCTATGGGAAGGTCCTGAGAG 0: 1
1: 0
2: 0
3: 8
4: 126
Right 1065307089 10:24379555-24379577 TGTAGGAAGGTGTGATTGTCTGG No data
1065307084_1065307091 29 Left 1065307084 10:24379529-24379551 CCTCTATGGGAAGGTCCTGAGAG 0: 1
1: 0
2: 0
3: 8
4: 126
Right 1065307091 10:24379581-24379603 ATGCAATTGGTTCTGTTGAGAGG No data
1065307084_1065307090 16 Left 1065307084 10:24379529-24379551 CCTCTATGGGAAGGTCCTGAGAG 0: 1
1: 0
2: 0
3: 8
4: 126
Right 1065307090 10:24379568-24379590 GATTGTCTGGATAATGCAATTGG No data
1065307084_1065307087 -10 Left 1065307084 10:24379529-24379551 CCTCTATGGGAAGGTCCTGAGAG 0: 1
1: 0
2: 0
3: 8
4: 126
Right 1065307087 10:24379542-24379564 GTCCTGAGAGGCATGTAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065307084 Original CRISPR CTCTCAGGACCTTCCCATAG AGG (reversed) Intronic
900217544 1:1489805-1489827 GACTCAGGTCCTTCCCAGAGAGG + Intronic
903230935 1:21921969-21921991 GACTTAGGGCCTTCCCATAGCGG + Intronic
904442308 1:30539708-30539730 CTCTCAGAACCTGCACTTAGAGG - Intergenic
909195938 1:72623375-72623397 CTATCAGGATCTGCCAATAGAGG + Intergenic
911003116 1:93188684-93188706 TTCTTAGGACCTTCCCATTCTGG + Intronic
923338502 1:232989499-232989521 CTGTCATGCCCTTCCCAGAGAGG + Intronic
924063471 1:240200224-240200246 CTCTCAGGACCCACACAAAGTGG - Intronic
1064056629 10:12103258-12103280 CTCCCAGGGTCTTCACATAGAGG - Intronic
1065307084 10:24379529-24379551 CTCTCAGGACCTTCCCATAGAGG - Intronic
1067076155 10:43184363-43184385 CTATCAGGGTCTTCCCATGGTGG + Exonic
1073596251 10:104803403-104803425 CTCTCAGGAGCTGCCTGTAGGGG + Intronic
1076772162 10:132671622-132671644 CTGTCAGCACCTTCCCATGCTGG - Intronic
1078916536 11:15783827-15783849 CTATCAGGCCCCTCCCAGAGAGG + Intergenic
1079249352 11:18775779-18775801 CTCTAAGGGCCTTTCCTTAGAGG + Intronic
1079508525 11:21183011-21183033 CTCTCAGGCTCTGCCCATATGGG - Intronic
1079861711 11:25680734-25680756 ATTTCAGGATCTTCCCATTGCGG + Intergenic
1079930040 11:26547030-26547052 CTCTCAGCACCCACCCAGAGGGG + Intronic
1080370842 11:31640833-31640855 CTCTCAGGACTTTCTTACAGTGG - Intronic
1083051340 11:59779449-59779471 CTCTAAGTACCATCCCATTGGGG + Intronic
1084598581 11:70131781-70131803 CCCTCAGGTCCATGCCATAGTGG - Intronic
1086541367 11:87916286-87916308 CTCTCAACACCTTCACATTGGGG - Intergenic
1086570870 11:88282904-88282926 CTCTCAGGACCTTGCCATGTGGG - Intergenic
1089309496 11:117548400-117548422 CTGCCAGCTCCTTCCCATAGGGG + Intronic
1093321714 12:17721848-17721870 CTCTCATTTCCTTCCCATCGTGG - Intergenic
1093703800 12:22253104-22253126 TCCTCAGGCCCTTCCCATTGTGG - Intronic
1096509916 12:52122024-52122046 TTCTCAGGACCTCCCACTAGAGG - Intergenic
1097502136 12:60417961-60417983 CTCTCTTCACCTTCCCATACTGG - Intergenic
1101759044 12:107644216-107644238 CTCTCAGCACATTCCCATTTAGG - Intronic
1103503056 12:121419964-121419986 CTCTCAGGAAGGTCCCATAATGG - Intronic
1106482538 13:30147635-30147657 CTCTCATGCCTTTCCCTTAGGGG + Intergenic
1107355195 13:39559017-39559039 CTCTCAGCACCTCTCCATCGGGG - Intronic
1108062027 13:46543118-46543140 CACTCAGCACCTTCCCCAAGGGG - Intergenic
1112418837 13:99228861-99228883 CTCACAAGACCTTACCAGAGAGG + Intronic
1119168602 14:72515818-72515840 TCCTCAGGGCCTTCCCACAGGGG + Intronic
1119438640 14:74613398-74613420 CTCTCGGGAATTTCCCAGAGGGG + Intergenic
1121389631 14:93562999-93563021 CTCTCATTTCCTTTCCATAGTGG - Intronic
1122127570 14:99587472-99587494 CTCTCTGGGCCATCCCATAGGGG - Intronic
1122236230 14:100332125-100332147 CTCTCTGGTCATTACCATAGAGG - Intergenic
1122318261 14:100838173-100838195 ATCTCAGGACTTTCCCAAGGTGG + Intergenic
1122641545 14:103162692-103162714 CTCTGAGGACCTTTCCTTATCGG + Intergenic
1124940918 15:34217171-34217193 CTCTAAATACCATCCCATAGAGG + Intergenic
1126312056 15:47328628-47328650 AGCTCAGGTCCTGCCCATAGAGG + Intronic
1126811792 15:52413999-52414021 CTCCCAGCACCTTCACATTGGGG - Intronic
1129064318 15:72888551-72888573 CTCTCAGGAGAAACCCATAGGGG - Intergenic
1129606650 15:77028337-77028359 CTCTCAGGCCCTCCCCACTGAGG - Intronic
1130863383 15:87910394-87910416 CTCTTGGGAGCTTCCCAAAGGGG - Intronic
1130982615 15:88823129-88823151 CTCCCAGCCCCTTCTCATAGAGG + Intronic
1135889475 16:26344382-26344404 CTCTTAGCACCTTCCCATCCAGG - Intergenic
1139611375 16:68061409-68061431 CTCTCAAGACCTTCCCAGAAGGG - Intronic
1140871797 16:79113418-79113440 CTCTCAGGACATTCACATCCAGG + Intronic
1140907233 16:79419227-79419249 CTCCCAGCAGCCTCCCATAGAGG + Intergenic
1141734331 16:85842114-85842136 CTCTCAGGGCCTTTCCAAAAGGG - Intergenic
1142272895 16:89100183-89100205 CTCTCAGACCCTTCCCACACTGG - Intronic
1144580604 17:16456960-16456982 CTCTCCAGACCTTCCCAGTGAGG + Intronic
1147339254 17:39744200-39744222 CCCTCAAGACCTTACCTTAGAGG - Exonic
1148656847 17:49290632-49290654 AAGCCAGGACCTTCCCATAGGGG - Intronic
1154336964 18:13473786-13473808 CTCTCAGGAACTTCACTTTGGGG - Intronic
1156346960 18:36266100-36266122 CTCTGATGACCTTCTCACAGGGG + Intronic
1157471835 18:47994826-47994848 GCCTCAGGACTTTCCCATAGTGG - Intergenic
1159402004 18:67950817-67950839 CACTCAGTATCATCCCATAGCGG + Intergenic
1160970839 19:1767118-1767140 CTCTCAGGATCTTCCTGGAGAGG - Intronic
1161162111 19:2767397-2767419 GTCTCAGGACCCGCCGATAGGGG + Intronic
1163196632 19:15726372-15726394 CTCTCATCACCTTCCCTGAGTGG - Intergenic
1163782181 19:19256413-19256435 TTCTCAGGAACTTCTCATTGTGG - Exonic
1163907449 19:20159605-20159627 CTCTCATTTCCTTCCCATTGTGG + Intergenic
1165769053 19:38367874-38367896 GTCTCAGGCCCTGCCCACAGTGG + Intronic
1166366051 19:42279088-42279110 CTCTGAGGCCCTACCCATTGGGG - Intronic
1168134347 19:54340071-54340093 CTCTCAGAGCCTCCCCATGGAGG + Intergenic
926509238 2:13752903-13752925 CTTTCAGGACCTACCCATCTAGG + Intergenic
926815270 2:16793581-16793603 CTCTCATTTCCTTTCCATAGTGG - Intergenic
926904452 2:17792828-17792850 CCCTCAAGCCCTTCCCAGAGAGG + Intronic
927800163 2:26091409-26091431 CTCTCACTACCTTTCCATAAAGG - Intronic
930758505 2:55004835-55004857 CCCTCATGCCCTTCCCTTAGGGG + Intronic
934564407 2:95330373-95330395 CTCTGAGGGCCATCCCATATGGG + Intronic
940044447 2:149393961-149393983 CTCTCCAGACCTGCCGATAGAGG + Intronic
948081360 2:235207803-235207825 CTCTCAGAAACTACCCAGAGGGG - Intergenic
1172205547 20:33160447-33160469 TTCCCAGGAGCCTCCCATAGTGG - Intergenic
1172997876 20:39084034-39084056 CTCTCAGGCCCATCCATTAGCGG - Intergenic
1176172715 20:63703419-63703441 CCCCCAGGAACTTCCCACAGTGG + Intronic
1178743580 21:35226278-35226300 CTCTCTGGACTTTCACTTAGGGG + Intronic
954989204 3:54824707-54824729 CTCTCAGGAAAATCCCATAAGGG - Intronic
955343368 3:58142791-58142813 CTCTCACGAGCTTCCCAGAATGG + Intronic
955807175 3:62748926-62748948 CTCACATGACCTTCCCATCTTGG + Intronic
959166140 3:102780677-102780699 GTCTCAGGAGATTCCCATTGTGG - Intergenic
962069084 3:132014253-132014275 CTCTCAGAGCCTTCCCTAAGGGG + Intronic
968977420 4:3829281-3829303 CTCCCAGAACCTTCCGATGGTGG + Intergenic
969299840 4:6291422-6291444 GAGCCAGGACCTTCCCATAGGGG + Intronic
969364670 4:6687264-6687286 GTCTCAGGACATTCTCACAGGGG - Intergenic
970503471 4:16702809-16702831 CACTCATGACCTTCCCATGACGG + Intronic
972256266 4:37358976-37358998 TTCCCAGGACACTCCCATAGTGG - Intronic
980885684 4:138759890-138759912 CTCTGTGGACATTCCCTTAGAGG + Intergenic
981135262 4:141203884-141203906 TTCTCTAGACCTTCCCAGAGGGG + Intronic
985030767 4:185787015-185787037 CTCTCAGAAACCTCCCAGAGAGG - Intronic
985538189 5:475916-475938 CTCTCAGGACCTTCCCCTCTGGG - Intronic
986438667 5:7759475-7759497 CTGTCAGGACCTCTCCACAGGGG - Intronic
988479451 5:31617926-31617948 TTCACAGGATCTTCCCACAGTGG - Intergenic
989107398 5:37876468-37876490 CCCTCAGGACCTTGCCACATGGG - Intergenic
990905120 5:60795218-60795240 CTCTCAGTACCTTCCTCTCGGGG - Intronic
991191134 5:63875448-63875470 CTCACTGTACCTTCACATAGTGG + Intergenic
994125760 5:96167972-96167994 CTCTCATTTCCTTCCCATGGTGG - Intergenic
997682001 5:135763406-135763428 AGCTCAGGACCTGCCCGTAGTGG + Intergenic
997818386 5:137039749-137039771 CTTTCAGGACCTGCCCAATGTGG - Intronic
1001334010 5:170783028-170783050 CTTTCAGGAGCATCCCAGAGAGG - Intronic
1001525872 5:172428496-172428518 CACTGAGGATCTTCCCAGAGTGG - Intronic
1001878173 5:175218778-175218800 CGCTGAGGAACTTCCAATAGTGG - Intergenic
1001910963 5:175517425-175517447 CTCTCTGGACCTTCACAATGGGG - Intronic
1002192918 5:177488169-177488191 CTTCCAGGACCTTCCCACACTGG + Exonic
1003249555 6:4413976-4413998 CTCTCAGTACCTTACCAGATGGG - Intergenic
1003840768 6:10117023-10117045 CTCTCAGTTCCTTGCCATATGGG + Intronic
1007509216 6:42362635-42362657 CTCTGTGGAGCTTCCCACAGTGG + Intronic
1014188309 6:118460547-118460569 TTCTCAGGGCCTTCTCATAAAGG - Intergenic
1015823706 6:137289999-137290021 CTCCCAGGAGCTTCCCAGGGTGG + Intergenic
1022169305 7:27808556-27808578 CTCTCAGAACATTCCCATGATGG + Intronic
1027372014 7:77516194-77516216 CTATCAGGAGCTTGCCATATAGG + Intergenic
1030441383 7:109593469-109593491 CTCTCATTTCCTTTCCATAGTGG - Intergenic
1031482333 7:122293441-122293463 CTCACAGGGCCTTTCCTTAGTGG - Intergenic
1031691117 7:124789017-124789039 CTCACAGGGCCTGCCCATACAGG + Intronic
1033234295 7:139625894-139625916 CTCCCAGAACCTTCCCAGAGTGG - Intronic
1034522252 7:151629454-151629476 TGGTCAAGACCTTCCCATAGAGG + Intronic
1035739512 8:1915565-1915587 CTTTCAGGACAGTCCCACAGTGG + Intronic
1036070614 8:5438072-5438094 CTCTCATTTCCTTCCCATCGTGG - Intergenic
1037246053 8:16836331-16836353 CTCTCAGTTCCTTCCTATATAGG + Intergenic
1039191380 8:34980013-34980035 CTCTCAGGACCTACAAATACTGG - Intergenic
1040122817 8:43701340-43701362 CATTCAGGACCTTCCCCTAAAGG + Intergenic
1040735367 8:50500963-50500985 GTCTCAGGACCTTGACAAAGTGG + Intronic
1042800453 8:72712441-72712463 GTCACAGGACCAGCCCATAGAGG - Intronic
1047570646 8:126095188-126095210 CTCTCAGCACCTTCCCAGTTTGG + Intergenic
1051124215 9:13785949-13785971 CTCTCAGAACATTCCCCTAAAGG - Intergenic
1051144775 9:14015530-14015552 CTCTCAAAATCTTCCAATAGTGG + Intergenic
1057149343 9:92782580-92782602 GGCTCAGGTCCTTCTCATAGTGG + Intergenic
1057855703 9:98599368-98599390 CCCTGAGGGCCTTGCCATAGTGG + Intronic
1061444520 9:130630346-130630368 CACTCACGACCTTCACATGGAGG + Intronic
1193322163 X:80135501-80135523 CTCTCAAGACCTTTCCAAAGAGG - Intergenic
1201251878 Y:12067037-12067059 CTCTCTGTACCTTCACACAGAGG + Intergenic
1201319965 Y:12687717-12687739 CTTTCAGGACCTACCCATATAGG + Intergenic