ID: 1065307416 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:24382191-24382213 |
Sequence | GTTTGCAAACAGATGGGCTT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1065307411_1065307416 | 7 | Left | 1065307411 | 10:24382161-24382183 | CCATGTTAAGGTTCTGATTTGGG | No data | ||
Right | 1065307416 | 10:24382191-24382213 | GTTTGCAAACAGATGGGCTTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1065307416 | Original CRISPR | GTTTGCAAACAGATGGGCTT GGG | Intronic | ||
No off target data available for this crispr |