ID: 1065307416

View in Genome Browser
Species Human (GRCh38)
Location 10:24382191-24382213
Sequence GTTTGCAAACAGATGGGCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065307411_1065307416 7 Left 1065307411 10:24382161-24382183 CCATGTTAAGGTTCTGATTTGGG No data
Right 1065307416 10:24382191-24382213 GTTTGCAAACAGATGGGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065307416 Original CRISPR GTTTGCAAACAGATGGGCTT GGG Intronic
No off target data available for this crispr