ID: 1065316309

View in Genome Browser
Species Human (GRCh38)
Location 10:24467261-24467283
Sequence TCCGTGTGCAGTCTGTGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065316303_1065316309 27 Left 1065316303 10:24467211-24467233 CCCCAGATATTTTCTGGTGTTTC 0: 1
1: 0
2: 3
3: 22
4: 287
Right 1065316309 10:24467261-24467283 TCCGTGTGCAGTCTGTGGGCAGG No data
1065316304_1065316309 26 Left 1065316304 10:24467212-24467234 CCCAGATATTTTCTGGTGTTTCA No data
Right 1065316309 10:24467261-24467283 TCCGTGTGCAGTCTGTGGGCAGG No data
1065316305_1065316309 25 Left 1065316305 10:24467213-24467235 CCAGATATTTTCTGGTGTTTCAG No data
Right 1065316309 10:24467261-24467283 TCCGTGTGCAGTCTGTGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065316309 Original CRISPR TCCGTGTGCAGTCTGTGGGC AGG Intronic
No off target data available for this crispr