ID: 1065318722

View in Genome Browser
Species Human (GRCh38)
Location 10:24488928-24488950
Sequence CAGTGCCTCTGCTGTGTCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065318721_1065318722 -7 Left 1065318721 10:24488912-24488934 CCTGGGAAAGGGGATGCAGTGCC No data
Right 1065318722 10:24488928-24488950 CAGTGCCTCTGCTGTGTCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065318722 Original CRISPR CAGTGCCTCTGCTGTGTCCA CGG Intronic