ID: 1065322731

View in Genome Browser
Species Human (GRCh38)
Location 10:24524269-24524291
Sequence CTCATGTCACTTTCTCATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 262}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065322731_1065322737 23 Left 1065322731 10:24524269-24524291 CCACCATGAGAAAGTGACATGAG 0: 1
1: 0
2: 3
3: 28
4: 262
Right 1065322737 10:24524315-24524337 TCTCCTAGACATGTCACTGATGG 0: 1
1: 0
2: 0
3: 13
4: 126
1065322731_1065322735 -2 Left 1065322731 10:24524269-24524291 CCACCATGAGAAAGTGACATGAG 0: 1
1: 0
2: 3
3: 28
4: 262
Right 1065322735 10:24524290-24524312 AGGGTTAATGCCGCTGTGCATGG 0: 1
1: 0
2: 0
3: 2
4: 64
1065322731_1065322738 24 Left 1065322731 10:24524269-24524291 CCACCATGAGAAAGTGACATGAG 0: 1
1: 0
2: 3
3: 28
4: 262
Right 1065322738 10:24524316-24524338 CTCCTAGACATGTCACTGATGGG 0: 1
1: 0
2: 2
3: 6
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065322731 Original CRISPR CTCATGTCACTTTCTCATGG TGG (reversed) Intronic
900978873 1:6035056-6035078 CCAAGGTCACCTTCTCATGGAGG - Intronic
901153732 1:7121938-7121960 CTGATGTCACCTTCTCCTTGGGG + Intronic
901155859 1:7137754-7137776 CAAATGTCACCTTCTCAAGGAGG + Intronic
901909028 1:12439393-12439415 CAAATGTCACTTTCTCAGGGAGG + Intronic
902696805 1:18145705-18145727 CTCATGTCGGCTTCTCAGGGCGG + Intronic
903555681 1:24191385-24191407 CACATGCCACTTCCTCAGGGAGG + Intergenic
903696604 1:25212007-25212029 CGTATGTCACTTCCTGATGGAGG + Intergenic
904208989 1:28873454-28873476 CTCAGGCCCCTTTCTAATGGAGG + Intergenic
904796951 1:33063424-33063446 CAAATGTCACCTTCTCAAGGAGG - Intronic
905226839 1:36484419-36484441 CAAATGTCACTTTCTCATTGAGG + Intergenic
905366996 1:37457830-37457852 CTAATGTCCCTTTCTGAAGGTGG - Intergenic
905451320 1:38058668-38058690 CCCATGTCACATCCTCAGGGAGG - Intergenic
905483630 1:38279849-38279871 CACATGTCACCCTGTCATGGAGG + Intergenic
906938688 1:50236776-50236798 CTCATGCCACTGACACATGGAGG - Intergenic
907557469 1:55357019-55357041 ATCATGACACTTTCAGATGGTGG + Intergenic
908482752 1:64558373-64558395 CCCATGTCACCTTCTCAATGAGG + Intronic
909146063 1:71933608-71933630 CTCATGTCGGTTTCTGAAGGTGG + Intronic
910045396 1:82907830-82907852 ATCATGTCACTTTCACAATGAGG + Intergenic
911772817 1:101768646-101768668 TACATGTCACTTTCTAAAGGAGG + Intergenic
913253882 1:116937048-116937070 CTAATGTCACCTTCTCAATGAGG - Intronic
913537814 1:119791066-119791088 CTCATGGCAGTTTATTATGGTGG - Intergenic
913564913 1:120063449-120063471 CTCAGGTAACATTCTAATGGAGG + Intronic
913633217 1:120730114-120730136 CTCAGGTAACATTCTAATGGAGG - Intergenic
914285499 1:146222799-146222821 CTCAGGTAACATTCTAATGGAGG + Intronic
914546530 1:148673554-148673576 CTCAGGTAACATTCTAATGGAGG + Intronic
914620035 1:149397116-149397138 CTCAGGTAACATTCTAATGGAGG - Intergenic
914701653 1:150139430-150139452 CAAATGTCAGTTTCTCAGGGAGG + Intronic
915119082 1:153617339-153617361 CTCATGTCACCTTCTCAACCTGG + Intergenic
916445686 1:164869789-164869811 CAAATGTCACTTTCTCAGTGAGG - Intronic
917300769 1:173571474-173571496 CAAATGTCACTTTCTCATTGAGG + Intronic
918720176 1:187842421-187842443 CTCATGTAACTATGTCATGTGGG + Intergenic
919688981 1:200511612-200511634 CTCATGTCACATTTTAATGTGGG - Intergenic
919758406 1:201080686-201080708 CTGATGACTCTTTCTCAGGGTGG + Intronic
919932107 1:202227857-202227879 CTCAAGACACTTTCTTATGGAGG + Intronic
920927134 1:210352397-210352419 CTCATCTCACTTTCTAATTCAGG + Intronic
921121395 1:212140548-212140570 CTCATGTTACATTCTAGTGGAGG - Intergenic
924563925 1:245180239-245180261 CTCATGTATCTTTCTCTTTGGGG + Intronic
924861866 1:247933442-247933464 CAAATGTCACTTTCCCAAGGAGG - Intergenic
1064923684 10:20546876-20546898 CTCATGTCATTATCTCATAGTGG + Intergenic
1065322731 10:24524269-24524291 CTCATGTCACTTTCTCATGGTGG - Intronic
1065738713 10:28777242-28777264 TTCATGTCACTATTTCATGAAGG - Intergenic
1067045948 10:42985292-42985314 CTCATGACATCTTCCCATGGTGG + Intergenic
1067085521 10:43236016-43236038 CTCTTCTCTCTTTCTCATTGGGG - Intronic
1067263158 10:44712387-44712409 TCCATGTCACTCTGTCATGGTGG - Intergenic
1068265958 10:54650306-54650328 CTCAAGTTGCTTTCTCATTGTGG - Intronic
1068369918 10:56099562-56099584 CTCATATGAGTTTTTCATGGTGG - Intergenic
1072276740 10:93830595-93830617 CACATGTCACCTTCTCAGAGAGG + Intergenic
1072551058 10:96478043-96478065 CTCATGCCACTTGCTCAAGGTGG - Intronic
1075304412 10:121355153-121355175 CTCAAATCACTTGCTCTTGGGGG - Intergenic
1075832873 10:125426219-125426241 ATCATGTCACTTTCACGTGCTGG + Intergenic
1078172255 11:8937155-8937177 CCCAAGACACTTTCCCATGGTGG + Intergenic
1078344091 11:10528246-10528268 CTCCTATCAGTTTTTCATGGTGG + Intronic
1081348744 11:42022929-42022951 CTCATTTCTAGTTCTCATGGTGG - Intergenic
1081475023 11:43421176-43421198 CAAATGTCACTTTCTCAGTGGGG - Intronic
1081523630 11:43907627-43907649 CACAAGTCACATTTTCATGGAGG + Intronic
1082133903 11:48525675-48525697 ATAATGTTACTTTCTCATGGTGG - Intergenic
1082566921 11:54692062-54692084 AGAATGTTACTTTCTCATGGTGG - Intergenic
1082756031 11:57077549-57077571 CAAATGTCACCTTCTCAAGGAGG - Intergenic
1084026111 11:66450825-66450847 CTAATGTCACTTCCTCAAAGAGG - Intronic
1084566032 11:69929600-69929622 CTCATGTCACAATCCAATGGAGG - Intergenic
1085396958 11:76211249-76211271 CTCGTGTCTCTTTCTCTTGCAGG - Intergenic
1086094476 11:83036713-83036735 CACATCTCACTTTCTCAGAGAGG - Intronic
1089757862 11:120699690-120699712 TACATGTCACTTTCTCAGAGAGG - Intronic
1090542070 11:127717627-127717649 CTGCTGACTCTTTCTCATGGTGG - Intergenic
1090956026 11:131513475-131513497 CTCATGTCACAGGCTCAGGGAGG - Intronic
1091818918 12:3459806-3459828 TCCCTGTCTCTTTCTCATGGTGG + Intronic
1092180607 12:6444205-6444227 CTCATGTCAGTCTCTGATGTGGG - Intergenic
1092522873 12:9291730-9291752 CTCAGCTCACTTTCAAATGGAGG + Intergenic
1092531406 12:9348648-9348670 TCCCTGTCTCTTTCTCATGGTGG - Intergenic
1092544415 12:9440167-9440189 CTCAGCTCACTTTCAAATGGAGG - Intergenic
1093433505 12:19109622-19109644 CTAATGTCACTTTCTGAAGTTGG + Intergenic
1094508535 12:31081900-31081922 CTCAGCTCACTTTCAAATGGAGG + Intronic
1094709181 12:32943893-32943915 CTCATGTTACTTCCTCAAGCTGG + Intergenic
1096683451 12:53272375-53272397 CTCATGTCACCCTCTCAATGAGG - Intronic
1097179042 12:57160486-57160508 CTCATGCCACCTCCTCATGGTGG + Intronic
1098465102 12:70777822-70777844 CTCATGTCACTATTTAATGTGGG - Intronic
1099514728 12:83584031-83584053 CACATGTCAACTTCTCATGGAGG + Intergenic
1100359176 12:93860580-93860602 CTCCTGTCACCTTCTTGTGGGGG - Intronic
1101378083 12:104188258-104188280 CAAATGTCACCTTCTCATTGAGG + Intergenic
1102330062 12:112021352-112021374 CTGATGTCACCTTCACAGGGAGG + Intronic
1104074230 12:125375521-125375543 CTGATGTAACTTTTTCATGTTGG - Intronic
1104612756 12:130242866-130242888 CTCATGTCACCTTCCCCAGGAGG + Intergenic
1105325811 13:19370024-19370046 CAGATGTCACCTTCTCAGGGAGG - Intergenic
1105867693 13:24475070-24475092 CAGATGTCACCTTCTCAGGGAGG + Intronic
1107445189 13:40464280-40464302 CTTGTGGCACTTTTTCATGGCGG + Intergenic
1109568061 13:64144800-64144822 TTCAAATCATTTTCTCATGGTGG + Intergenic
1110628150 13:77674995-77675017 CTACTGTGCCTTTCTCATGGAGG - Intergenic
1111565558 13:90010054-90010076 CTCATCCTACTTTGTCATGGAGG - Intergenic
1115702584 14:35969179-35969201 TTCATGTCTCTTTCTCATATTGG + Intergenic
1121597759 14:95178856-95178878 CCCAGGTCACATTCTCTTGGGGG + Intergenic
1124499099 15:30211076-30211098 TAAATGTCACTTTCTCAGGGAGG + Intergenic
1124744478 15:32327597-32327619 TAAATGTCACTTTCTCAGGGAGG - Intergenic
1125078354 15:35647670-35647692 CTCATGTCACAATCTGATGCAGG - Intergenic
1126255297 15:46618131-46618153 GTTATATCACTTTCCCATGGAGG - Intergenic
1126531034 15:49711326-49711348 CAAATATCACCTTCTCATGGAGG + Intergenic
1127430309 15:58900247-58900269 CTTTTGTCACTGTCACATGGAGG - Intronic
1128868198 15:71131965-71131987 CTCAAGTCACTATCTGATGCAGG - Intronic
1129515141 15:76152686-76152708 CACATGTCGCTTTCTCACTGAGG + Intronic
1129556918 15:76520051-76520073 CTCATGTTACTTCCTCAAAGGGG + Intronic
1130179586 15:81611599-81611621 CACATGTCACTTCCTCAGGGAGG + Intergenic
1130381159 15:83373637-83373659 CTCATATCCCCTTCTCCTGGGGG + Intergenic
1130511681 15:84594899-84594921 CTCATGACACCTGCCCATGGAGG + Intergenic
1130550614 15:84888128-84888150 CTAATGTCACTTCCTCACTGGGG - Intronic
1130720124 15:86378397-86378419 CTCTTGCCACTTTCTTTTGGGGG + Intronic
1131718447 15:95139797-95139819 ACCATATCACTGTCTCATGGTGG + Intergenic
1132789213 16:1675761-1675783 CTCATGTCAATGTCTGAAGGAGG - Exonic
1132917481 16:2359622-2359644 CAAATGTCACTTTCTCAGTGAGG - Intergenic
1133527277 16:6617830-6617852 CTCACATCACTTCCTCAAGGAGG - Intronic
1134595385 16:15491785-15491807 CAAATGCCACTTTCTCATAGAGG + Intronic
1134852138 16:17488479-17488501 CTCCTCTCTCTCTCTCATGGAGG - Intergenic
1135295296 16:21274352-21274374 CAAATGTCACCTTCTCAGGGAGG + Intronic
1135960831 16:26993345-26993367 CTCATGTCAGTTTCCCATCCTGG + Intergenic
1137710960 16:50566559-50566581 CTCAAGTCAGTTTCTCATTAGGG - Intronic
1137766036 16:50978379-50978401 CTAATGTCACTTTCTCAATGAGG + Intergenic
1140635359 16:76906783-76906805 CTCATGTTACTTTCCTTTGGTGG - Intergenic
1142518506 17:489500-489522 CTCATGTCACCTCCTCTGGGAGG - Intergenic
1144183846 17:12777685-12777707 CTCTTGTCAGTTTCTCCTGAAGG + Intergenic
1144761012 17:17707398-17707420 CACCTGTCACCTTCTCAGGGAGG - Intronic
1146127064 17:30238206-30238228 CTAATGTCATTTGCTAATGGTGG - Intergenic
1146328829 17:31910543-31910565 CAAATGTCACTCTCTCAGGGAGG + Intergenic
1147694510 17:42341125-42341147 CTCATGTCTATTTCTCAAGCAGG + Intronic
1148853300 17:50565243-50565265 CTCATGTCTCTGTCTCTGGGTGG + Intronic
1153406000 18:4740274-4740296 CAAATGTCACCTTCTCAGGGAGG + Intergenic
1155680324 18:28479129-28479151 CTCATGACACTTTCTCAGGGTGG - Intergenic
1157575147 18:48738608-48738630 TCCATGTCACCTTCTCAGGGAGG + Intronic
1159259750 18:65998382-65998404 CTCATGCCACAATCTAATGGGGG - Intergenic
1159388425 18:67757485-67757507 CTCATGTCTTTTGCTCATGAAGG - Intergenic
1159999912 18:75007824-75007846 CTGATGTAAATTTCCCATGGAGG - Intronic
1160276735 18:77444163-77444185 CACATGTCACAATGTCATGGTGG - Intergenic
1160765791 19:807089-807111 CTCCTGTGACTTCCTCAAGGCGG + Intronic
1162554795 19:11380130-11380152 CTGATGTCACCTCCTCCTGGAGG + Intronic
1162819395 19:13213340-13213362 CACATGTCACTTTCTCAGGGAGG + Intronic
1165132987 19:33644863-33644885 CTCATCTCACCTTCTCAGGGAGG - Intronic
1165438096 19:35807685-35807707 CTAATGTCACTTTCTCAACATGG + Intronic
1165685855 19:37819075-37819097 CTCAAGTCCCTTTCTTTTGGGGG + Intergenic
1165791957 19:38497995-38498017 CAAATGTCACTTTCTCAATGAGG - Intronic
1166342813 19:42149013-42149035 CTCCTCTCTCCTTCTCATGGTGG - Intronic
1167444727 19:49530831-49530853 CACATACCACCTTCTCATGGAGG - Intronic
926497013 2:13603175-13603197 CTCTGCTCAATTTCTCATGGGGG - Intergenic
927730713 2:25469196-25469218 TTGATGTCACTTTCTGAGGGAGG - Intronic
929052703 2:37851527-37851549 TAAATGTCACTTTCTCAGGGAGG + Intergenic
930243254 2:48957573-48957595 CTCAAGTCACGTTCTCAGGGAGG + Intergenic
930656566 2:54013098-54013120 AAAATGTCACTTTCTCAGGGAGG + Intronic
930806328 2:55494319-55494341 TAAATGTCACTTTCTCATAGAGG - Intergenic
930883277 2:56296082-56296104 CTGATGTCATTTTCACATAGAGG - Intronic
931653981 2:64493215-64493237 CAAATGTCACCTTCTCAGGGAGG - Intergenic
932273467 2:70432322-70432344 CTCATGAAACTTTTCCATGGTGG - Intergenic
932653764 2:73588775-73588797 CTCATTTTCTTTTCTCATGGAGG - Intronic
932907954 2:75774284-75774306 CTCAACTCACTTTCTCAGGAAGG + Intergenic
933737197 2:85504646-85504668 CTAATGTTACTTACTCATTGAGG + Intergenic
937434606 2:121870062-121870084 CTCAAGTCACCTTCACAGGGAGG + Intergenic
937668675 2:124515986-124516008 CTCCTGTCTCTTTCTGATAGAGG - Intronic
937968455 2:127532353-127532375 CTGAAGTCACTTGCTTATGGTGG - Intergenic
940136827 2:150446539-150446561 CCCTGGTCACTTTCCCATGGTGG - Intergenic
940338375 2:152552989-152553011 CTCATTTCACTTTCTCATTGTGG + Intronic
941760074 2:169232634-169232656 CAAATGTCACTTTCTCAGAGAGG - Intronic
943205789 2:184892831-184892853 CTCATGTCTCTTTATCATAAGGG + Intronic
944825894 2:203482898-203482920 CAAATGTCACTTTCTTATTGAGG - Intronic
944944990 2:204673625-204673647 CAAATGCCACTTTTTCATGGAGG + Intronic
946225092 2:218260308-218260330 CTCATGCCTCTTCATCATGGGGG + Intronic
946414545 2:219533223-219533245 GTCATTTCACTTTCTCAAAGTGG - Intronic
948431470 2:237921935-237921957 ATCATGGCACGTTCTCATTGTGG + Intergenic
948492969 2:238325524-238325546 CTCATTTCATTTTCTCATTGTGG + Intronic
1168903499 20:1385883-1385905 CAAATGTCACTTTCTCATTGAGG + Intronic
1169031771 20:2415100-2415122 GTAATGCCACCTTCTCATGGAGG - Intronic
1170743418 20:19077838-19077860 CACAGGTCACTTTTTCAGGGAGG - Intergenic
1171202851 20:23255896-23255918 CTCCTGTCTCTCTCTCCTGGAGG + Intergenic
1172281853 20:33713391-33713413 CCAATGTCACTTTCTCATAGCGG + Intronic
1173033423 20:39383688-39383710 TTCATGTCACTTTCTCTGTGAGG - Intergenic
1174073246 20:47913568-47913590 CACATGTCACTTCCTCAGAGAGG - Intergenic
1174500361 20:50979769-50979791 CAAATGTCGCTTTCTCAGGGAGG + Intergenic
1178798183 21:35765164-35765186 CCCATGTCACATGCTCATGCTGG + Intronic
1180623655 22:17179533-17179555 TTCATGTCACTGTCTCAGAGAGG - Exonic
1182042657 22:27250495-27250517 TAAATGTCACCTTCTCATGGAGG - Intergenic
1182072414 22:27473087-27473109 CTCTTGTCACTTCCACACGGGGG - Intergenic
1182307741 22:29382670-29382692 CACCTGTCACCTTCTCAAGGAGG - Intronic
1182399301 22:30062313-30062335 CTCATCTCCCTTTCCCATGGTGG - Intergenic
1184446085 22:44547676-44547698 CAAATGTCACTTCCTCAGGGAGG - Intergenic
1184479526 22:44738443-44738465 CTCATGGCGTTTTCTCAAGGTGG + Intronic
951371612 3:21857048-21857070 CACATGTCACTTTCTCATTTAGG + Intronic
954069084 3:48129851-48129873 CTCAGGTCACTTGCTCAAGCTGG + Intergenic
955129779 3:56154313-56154335 CTCATGTCATTTTCTAATCTAGG - Intronic
956900787 3:73713796-73713818 CACATGTCACCTTCTCAATGAGG + Intergenic
957843926 3:85705913-85705935 CTCATATAACTTGCTCATTGTGG + Intronic
959943303 3:112102213-112102235 ATGATGTCACTTCTTCATGGTGG + Intronic
960666834 3:120117435-120117457 AACAAGTCATTTTCTCATGGTGG - Intergenic
961502144 3:127343927-127343949 CTCATGTCCTTTCCTCTTGGTGG + Intergenic
961913226 3:130342870-130342892 CTCATGTCACCCTCTCATTAAGG + Intergenic
962090190 3:132236089-132236111 CAGATGTTACCTTCTCATGGAGG + Intronic
963433442 3:145238696-145238718 ACCATGTCACTTTCTAGTGGAGG + Intergenic
966465033 3:180222081-180222103 AGCATGTCACTTTTTCATGTTGG - Intergenic
966947801 3:184789667-184789689 CAGATGTCATTTTCTCACGGAGG - Intergenic
967802712 3:193681671-193681693 CTCATGTCACTGTCACATTTTGG + Intronic
968022234 3:195403101-195403123 CAAATGTCACTTTCTCAGTGAGG - Intronic
969345528 4:6567507-6567529 CAGATGTCACTTTCTCAATGTGG + Intergenic
969493114 4:7511052-7511074 CTCTTGACACTATCTCAGGGCGG + Intronic
970003907 4:11392564-11392586 CTAATACCACTTTCTCATGTTGG - Intergenic
971326238 4:25646133-25646155 CTCAAGTCACTCTCTCATTCTGG + Intergenic
971405291 4:26317254-26317276 CTGATGTCACCTCCTCAGGGAGG - Intronic
972963147 4:44477941-44477963 CTCCTCTCACCTTCTCAAGGAGG + Intergenic
976794270 4:88914582-88914604 CCCATGTCACTTCCTCAGAGAGG + Intronic
977231491 4:94455814-94455836 CTCAGCTCACTTTCTGGTGGAGG + Intronic
977559104 4:98514625-98514647 CTCATGTCACTTCATCCTGATGG + Intronic
978294450 4:107187579-107187601 CAAATGTCACCTTTTCATGGAGG + Intronic
978717890 4:111868205-111868227 CAAATGTCACTTTATCAAGGAGG - Intergenic
978997183 4:115171054-115171076 CTCAAGTCACCTTCTCAGTGAGG + Intergenic
979691194 4:123560317-123560339 CTCCTGTCTCTTTCTTAGGGTGG + Intergenic
979691198 4:123560365-123560387 CTCCTGTCTCTTTCTTAGGGTGG + Intergenic
980297922 4:130946553-130946575 CTTATGTCTCTTTCTCATAAAGG - Intergenic
981462201 4:145026499-145026521 CACACATCACTTTCTCATTGAGG - Intronic
983090967 4:163501844-163501866 CTCAGGTTACTTTCTCAGGGAGG + Intronic
983990676 4:174115708-174115730 CTCATGTCACGTTCACTTAGTGG - Intergenic
984604665 4:181771223-181771245 CTCATGTCTTTTTCTCATCCTGG - Intergenic
986421921 5:7593757-7593779 CTCATGACACATTCTAATTGGGG + Intronic
988163071 5:27546101-27546123 ATCATATCACATTCTCTTGGGGG + Intergenic
988326939 5:29781138-29781160 GTCATGTAACTTTATCAAGGTGG + Intergenic
988588434 5:32527945-32527967 TTCATGTCACCTTCTCAGAGAGG + Intergenic
989457424 5:41660174-41660196 CTCATGTCTCCTGCTCCTGGTGG + Intergenic
991412569 5:66359359-66359381 CTCAAGTCACTTGCCCAAGGTGG - Intergenic
994033826 5:95176087-95176109 CTCATTTGATTTTCTCAAGGAGG - Intronic
997897161 5:137729424-137729446 CTCAGGTCAGATCCTCATGGTGG + Intronic
999190999 5:149747578-149747600 CTCATGCCACTTTCTCCTTGGGG + Intronic
999388350 5:151171765-151171787 CTCATTTTTCTTCCTCATGGAGG - Intergenic
1000846355 5:166285653-166285675 CTACTGTTACTTTCTCAGGGAGG + Intergenic
1000852999 5:166363121-166363143 ATCATGTAAATTTCTCATGATGG - Intergenic
1001878829 5:175224638-175224660 CTCATGTCTCTTTCTGATCAGGG - Intergenic
1001884744 5:175279210-175279232 ATCAATTCACTTTCTCAAGGAGG + Intergenic
1002062667 5:176635387-176635409 CGAATGTCACTTTCTCCTGGAGG - Intronic
1004512237 6:16292381-16292403 CTCAAGTCTCTTTCTCTTGGTGG + Intronic
1004778713 6:18880531-18880553 CTCATGTGACTTTCAAATGTTGG + Intergenic
1006035882 6:31211789-31211811 CTCATTTCACTTTCCTAAGGAGG - Intergenic
1009482443 6:64176053-64176075 CTAATGTCACCTTCTCAGTGAGG - Intronic
1012732101 6:102895966-102895988 GTCATGTCATTTTCTTAGGGAGG + Intergenic
1014465602 6:121752892-121752914 TGTTTGTCACTTTCTCATGGGGG + Intergenic
1014580907 6:123136429-123136451 TAAATGTCATTTTCTCATGGAGG + Intergenic
1015330123 6:131968036-131968058 CCCATGTCACTTTCTTTTTGTGG + Intergenic
1016191209 6:141267475-141267497 CTCATATCACATTCACATAGAGG - Intergenic
1017267737 6:152469787-152469809 CTCAAGTCACTTGCTCCTGGCGG - Intronic
1017322116 6:153106211-153106233 CACATGTCACGTTCTGATGCAGG + Intronic
1018923423 6:168191051-168191073 GCACTGTCACTTTCTCATGGAGG + Intergenic
1022705406 7:32797449-32797471 CTCATGTAACTTCCTCCAGGAGG + Intergenic
1022834416 7:34100359-34100381 CAGATGTCATTTTCTCATGGAGG - Intronic
1023590199 7:41773576-41773598 TTCATGTCACTTTTTCATTCTGG + Intergenic
1023719930 7:43082475-43082497 CTCCTATCACTTACTCATTGGGG - Intergenic
1024122950 7:46263546-46263568 CTCATGTCACCCACTGATGGAGG + Intergenic
1024459527 7:49645689-49645711 ATCATGCCAGTTTATCATGGGGG - Intergenic
1024550877 7:50561505-50561527 CTCACTTCACTTTCTCATCTGGG - Intronic
1024865685 7:53903368-53903390 CTCAGGAAACTTTCACATGGTGG + Intergenic
1026103111 7:67398904-67398926 CTTCTGTCACATTGTCATGGGGG + Intergenic
1028243845 7:88452419-88452441 CACATTTCATTTTCTCAAGGAGG - Intergenic
1029225086 7:99020336-99020358 TTCATGTGACTTTGTGATGGAGG - Intergenic
1029877298 7:103767824-103767846 CTAATGTCACCTTCTCAGTGAGG + Intronic
1032081068 7:128858732-128858754 CTCATGTCACATTCCCAGGGAGG - Exonic
1032091181 7:128912425-128912447 CTCATATCACATTCCCAGGGAGG + Intergenic
1032805523 7:135350273-135350295 GGCATGTCACTTTCTCAGTGAGG + Intergenic
1033442090 7:141389316-141389338 CACATGTGACTTACTCATTGTGG - Intronic
1034069066 7:148164994-148165016 CCAAGGTCACTTTCTCAGGGAGG + Intronic
1038008174 8:23451814-23451836 ATAATGTCACCTTCTCAAGGAGG + Intronic
1038468418 8:27788663-27788685 CTCATTTCATTTTGTCTTGGGGG + Intronic
1038892039 8:31736310-31736332 CACATGCCACTTTCTCAGTGAGG + Intronic
1039010375 8:33086824-33086846 CTAATGTCACTTTCTCACTGAGG + Intergenic
1041525583 8:58801673-58801695 CTCCTGTCACTTACTTCTGGTGG - Intergenic
1043269577 8:78314801-78314823 CTCATATTATATTCTCATGGAGG - Intergenic
1043530353 8:81143178-81143200 CAAATGTCACTTTCTCAGAGAGG - Intergenic
1046097591 8:109579307-109579329 TCCATTTCACTTTCTCAGGGAGG + Intronic
1046676063 8:117110132-117110154 CTTCTGTCATTTTCTTATGGAGG - Intronic
1046717021 8:117579185-117579207 CACAAGTCACTTTCTCAGTGAGG - Intergenic
1047982658 8:130199040-130199062 TCCATGTCACTTTCTCAGTGAGG + Intronic
1049092563 8:140527532-140527554 CACCTGTGACTTTGTCATGGGGG - Intergenic
1049603862 8:143520187-143520209 CACCTGCCTCTTTCTCATGGTGG - Intronic
1053276050 9:36784137-36784159 TTCATGGCACTTTGTTATGGAGG - Intergenic
1054874144 9:70077633-70077655 ATCATCTCAATTTCTCATGAAGG - Intronic
1058523995 9:105839118-105839140 CCCATGTCACTTTCTCTGGGAGG - Intergenic
1058623627 9:106911192-106911214 CTCATGTTAGTTTCTGATGCTGG + Intronic
1058700899 9:107599310-107599332 CTCGTGACACTTTCTCTAGGAGG - Intergenic
1061043395 9:128152091-128152113 CTCAGATCCCTTCCTCATGGGGG - Intronic
1061334972 9:129927096-129927118 CTCATGTCATCATCTCATGGTGG - Intronic
1062028056 9:134349605-134349627 CTGATGTCACCCACTCATGGGGG - Intronic
1062091978 9:134683097-134683119 CTGCTGTCACCGTCTCATGGCGG - Intronic
1186145037 X:6616244-6616266 CTCACATCACTGTCTGATGGGGG + Intergenic
1186746575 X:12575978-12576000 CTCATGGTAATTTGTCATGGCGG + Intronic
1186753129 X:12642333-12642355 TAAATGTCACTTTCTCATTGAGG - Intronic
1188230185 X:27652791-27652813 CACATATCACTTTTTCATTGAGG - Intronic
1190810931 X:53882582-53882604 CACATGTCACCTTCTCAGTGAGG + Intergenic
1191710121 X:64140629-64140651 CACATGTCCCTTTCTCAGAGAGG + Intergenic
1192634347 X:72803822-72803844 CTCATTACACTTCCTCATGCTGG + Intronic
1192647363 X:72916979-72917001 CTCATTACACTTCCTCATGCTGG - Intronic
1194389100 X:93293989-93294011 TACATGTCACTTTCTCAGAGAGG - Intergenic
1195344006 X:103930340-103930362 CTAATGTCACATTCACTTGGGGG - Intronic
1196267265 X:113665093-113665115 CGAATGCCACTTTCTCATAGAGG - Intergenic
1197394198 X:125906652-125906674 TTTATGTCACATTCTCAAGGGGG - Intergenic
1200376426 X:155785423-155785445 CAAATGTCACTTCCTCAAGGAGG + Intergenic
1202337775 Y:23828842-23828864 CTCATGTACCTGTCTCTTGGTGG - Intergenic
1202532991 Y:25841229-25841251 CTCATGTACCTGTCTCTTGGTGG + Intergenic