ID: 1065325758

View in Genome Browser
Species Human (GRCh38)
Location 10:24549553-24549575
Sequence CTGTGCTTCTATCAGGGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065325758_1065325765 19 Left 1065325758 10:24549553-24549575 CCTGGACCCTGATAGAAGCACAG No data
Right 1065325765 10:24549595-24549617 CTCACTCTCTCCCCACCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065325758 Original CRISPR CTGTGCTTCTATCAGGGTCC AGG (reversed) Intergenic
No off target data available for this crispr