ID: 1065342530

View in Genome Browser
Species Human (GRCh38)
Location 10:24721752-24721774
Sequence AGTTGGGGGTTACCGGCCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 49}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065342530_1065342539 14 Left 1065342530 10:24721752-24721774 CCCGTGGCCGGTAACCCCCAACT 0: 1
1: 0
2: 0
3: 1
4: 49
Right 1065342539 10:24721789-24721811 GACACAGGCCACCGCCCTGCCGG 0: 1
1: 0
2: 2
3: 19
4: 175
1065342530_1065342543 27 Left 1065342530 10:24721752-24721774 CCCGTGGCCGGTAACCCCCAACT 0: 1
1: 0
2: 0
3: 1
4: 49
Right 1065342543 10:24721802-24721824 GCCCTGCCGGCCAGGAACGCTGG 0: 1
1: 0
2: 1
3: 15
4: 185
1065342530_1065342538 -1 Left 1065342530 10:24721752-24721774 CCCGTGGCCGGTAACCCCCAACT 0: 1
1: 0
2: 0
3: 1
4: 49
Right 1065342538 10:24721774-24721796 TTGCAGGACGCTCAAGACACAGG 0: 1
1: 0
2: 0
3: 3
4: 63
1065342530_1065342540 19 Left 1065342530 10:24721752-24721774 CCCGTGGCCGGTAACCCCCAACT 0: 1
1: 0
2: 0
3: 1
4: 49
Right 1065342540 10:24721794-24721816 AGGCCACCGCCCTGCCGGCCAGG 0: 1
1: 0
2: 1
3: 23
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065342530 Original CRISPR AGTTGGGGGTTACCGGCCAC GGG (reversed) Intronic
916674228 1:167053002-167053024 AGTTGGGTGAGACCAGCCACTGG + Exonic
920501470 1:206488070-206488092 AGCTGGAGGTTAGTGGCCACTGG - Intronic
924884566 1:248200425-248200447 TGTTGGGGGTTTCCTACCACAGG - Intergenic
1063437707 10:6048107-6048129 AGTTGAGGGTCAGGGGCCACGGG - Intronic
1065342530 10:24721752-24721774 AGTTGGGGGTTACCGGCCACGGG - Intronic
1069697086 10:70394470-70394492 AGTTGGGGATTACAGGCACCTGG - Intergenic
1075331008 10:121574010-121574032 AGTTGGGGGTTACTGGACCAGGG - Intronic
1077077095 11:706777-706799 AGCTGGTGCTTCCCGGCCACTGG - Exonic
1082819856 11:57537540-57537562 AGCTGGGGGCTAGAGGCCACTGG + Intergenic
1084575359 11:69985390-69985412 AGCTGGAGGTTACAGGTCACTGG - Intergenic
1086435044 11:86771825-86771847 AGTTGGGGGATTCCAGGCACAGG + Intergenic
1086923666 11:92616865-92616887 AGGTGGGGGTTACCGACAAACGG - Intronic
1096476971 12:51914270-51914292 AGCTGGGGGTGGCCTGCCACTGG + Intronic
1097089156 12:56491892-56491914 AGCTGGGGGTGAAGGGCCACTGG + Intergenic
1097199882 12:57269358-57269380 CGTTGGGGGCTATAGGCCACCGG + Exonic
1119364656 14:74081578-74081600 AGTTTGGGGTGACTGGCCACAGG - Intronic
1119364853 14:74083393-74083415 AGTTGGAGATTACAGGCCTCAGG + Intronic
1124074642 15:26433276-26433298 AGTTGGGGGTCAGCCTCCACAGG + Intergenic
1132625098 16:887882-887904 AGTTGCAGGCTGCCGGCCACAGG + Intronic
1134844562 16:17428984-17429006 AGTTGGGGTTTTTAGGCCACAGG - Intronic
1137659691 16:50193900-50193922 AGTGGGGACTTCCCGGCCACTGG + Intronic
1143047678 17:4095207-4095229 AGTTGGAGTTGATCGGCCACTGG - Intronic
1144061764 17:11589314-11589336 AGTGGGGGCTTACAGGTCACAGG - Intergenic
1152942250 17:83178818-83178840 TGTGGGGGGTGACCCGCCACGGG - Intergenic
1160993939 19:1873270-1873292 AGTCGGGGCTGACAGGCCACTGG + Intergenic
1162079051 19:8208279-8208301 AGTTGGGGCCTCCCTGCCACAGG - Intronic
1162146899 19:8617943-8617965 AGCTGGGGGCTTCCGGCCATGGG - Intergenic
928697102 2:33860408-33860430 AATTGAGGGTTGCCGGCCAAAGG - Intergenic
934568554 2:95353912-95353934 ATCTGGGGGTTACAGGCCAGGGG + Intronic
948709571 2:239817445-239817467 AGCTGGTGGTGACCAGCCACGGG - Intergenic
948786034 2:240353425-240353447 ACTTGGTGGTCACCGGCCCCAGG + Intergenic
1180188443 21:46151664-46151686 AGTTGGGGGGCCACGGCCACGGG - Exonic
952762576 3:36927666-36927688 TGTTGGGGGTGAGCGACCACTGG - Intronic
961090863 3:124111530-124111552 AGAAGGGGGTTAATGGCCACTGG + Intronic
968647176 4:1746771-1746793 AGATGGGGGTTGCTGCCCACGGG - Intergenic
971878806 4:32340953-32340975 AGTAGGGGGTTCCAGGCCATGGG - Intergenic
984770195 4:183430666-183430688 AGCAGGGGTTTACCGGCCAGAGG + Intergenic
1002763254 6:218049-218071 AGTTGTGAGTTCCCTGCCACAGG + Intergenic
1003183277 6:3810076-3810098 AGTTGGGGACTCCTGGCCACAGG - Intergenic
1019704033 7:2488934-2488956 AGTTGGGGGTCAGGGGCCAGGGG + Intergenic
1020710157 7:11596266-11596288 ATTTGGGGATTACTGGACACTGG + Intronic
1026787861 7:73313147-73313169 CGGTGGGGGTGGCCGGCCACGGG + Exonic
1027707378 7:81551054-81551076 AGTTGGGGCTTCCAGGTCACAGG - Intergenic
1029679189 7:102096261-102096283 AGTCAGGGGTTAGCGGCCGCAGG - Intronic
1030330288 7:108263148-108263170 AATTGGGGGTTTTCTGCCACAGG - Intronic
1035560165 8:598306-598328 AGATGGGGGTGGCCGGCAACGGG + Intergenic
1039883758 8:41643822-41643844 AGTTCTGGGATACCTGCCACTGG - Intergenic
1042207736 8:66345876-66345898 GCCTGGGGGTGACCGGCCACAGG - Intergenic
1048967413 8:139624789-139624811 AGTTGGGCATCACCGGCCCCCGG - Intronic
1052424192 9:28282948-28282970 AGTTTAGGTTTACCTGCCACAGG - Intronic
1062019849 9:134314062-134314084 AGTGGCAGGTTCCCGGCCACTGG - Intergenic