ID: 1065348813

View in Genome Browser
Species Human (GRCh38)
Location 10:24776464-24776486
Sequence CAATTACCACATAAAGGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065348806_1065348813 20 Left 1065348806 10:24776421-24776443 CCATCCATCCTAAGCCATACCAG No data
Right 1065348813 10:24776464-24776486 CAATTACCACATAAAGGAAGAGG No data
1065348807_1065348813 16 Left 1065348807 10:24776425-24776447 CCATCCTAAGCCATACCAGATGT No data
Right 1065348813 10:24776464-24776486 CAATTACCACATAAAGGAAGAGG No data
1065348805_1065348813 25 Left 1065348805 10:24776416-24776438 CCTTACCATCCATCCTAAGCCAT No data
Right 1065348813 10:24776464-24776486 CAATTACCACATAAAGGAAGAGG No data
1065348808_1065348813 12 Left 1065348808 10:24776429-24776451 CCTAAGCCATACCAGATGTTCTA No data
Right 1065348813 10:24776464-24776486 CAATTACCACATAAAGGAAGAGG No data
1065348809_1065348813 6 Left 1065348809 10:24776435-24776457 CCATACCAGATGTTCTAAGATAC No data
Right 1065348813 10:24776464-24776486 CAATTACCACATAAAGGAAGAGG No data
1065348810_1065348813 1 Left 1065348810 10:24776440-24776462 CCAGATGTTCTAAGATACTCACC No data
Right 1065348813 10:24776464-24776486 CAATTACCACATAAAGGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065348813 Original CRISPR CAATTACCACATAAAGGAAG AGG Intergenic
No off target data available for this crispr