ID: 1065350796

View in Genome Browser
Species Human (GRCh38)
Location 10:24793987-24794009
Sequence CTGGAAATGGCTTCCTTCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065350792_1065350796 -6 Left 1065350792 10:24793970-24793992 CCTAGATTCCCTGACTGCTGGAA No data
Right 1065350796 10:24793987-24794009 CTGGAAATGGCTTCCTTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065350796 Original CRISPR CTGGAAATGGCTTCCTTCTT TGG Intergenic
No off target data available for this crispr