ID: 1065351565

View in Genome Browser
Species Human (GRCh38)
Location 10:24800160-24800182
Sequence TTGGAGGACCAGAAATAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065351565_1065351573 12 Left 1065351565 10:24800160-24800182 CCTTCTTATTTCTGGTCCTCCAA No data
Right 1065351573 10:24800195-24800217 CTGTTCTCCAGCCCTATTATGGG No data
1065351565_1065351572 11 Left 1065351565 10:24800160-24800182 CCTTCTTATTTCTGGTCCTCCAA No data
Right 1065351572 10:24800194-24800216 CCTGTTCTCCAGCCCTATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065351565 Original CRISPR TTGGAGGACCAGAAATAAGA AGG (reversed) Intergenic
No off target data available for this crispr