ID: 1065355411

View in Genome Browser
Species Human (GRCh38)
Location 10:24835518-24835540
Sequence CCAGTCTTGACAGGGGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065355411_1065355417 -3 Left 1065355411 10:24835518-24835540 CCAGACACCCCTGTCAAGACTGG No data
Right 1065355417 10:24835538-24835560 TGGGACGTCTGCCCATCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065355411 Original CRISPR CCAGTCTTGACAGGGGTGTC TGG (reversed) Intergenic
No off target data available for this crispr