ID: 1065355417

View in Genome Browser
Species Human (GRCh38)
Location 10:24835538-24835560
Sequence TGGGACGTCTGCCCATCATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065355414_1065355417 -10 Left 1065355414 10:24835525-24835547 CCCCTGTCAAGACTGGGACGTCT No data
Right 1065355417 10:24835538-24835560 TGGGACGTCTGCCCATCATTTGG No data
1065355408_1065355417 0 Left 1065355408 10:24835515-24835537 CCCCCAGACACCCCTGTCAAGAC No data
Right 1065355417 10:24835538-24835560 TGGGACGTCTGCCCATCATTTGG No data
1065355411_1065355417 -3 Left 1065355411 10:24835518-24835540 CCAGACACCCCTGTCAAGACTGG No data
Right 1065355417 10:24835538-24835560 TGGGACGTCTGCCCATCATTTGG No data
1065355409_1065355417 -1 Left 1065355409 10:24835516-24835538 CCCCAGACACCCCTGTCAAGACT No data
Right 1065355417 10:24835538-24835560 TGGGACGTCTGCCCATCATTTGG No data
1065355410_1065355417 -2 Left 1065355410 10:24835517-24835539 CCCAGACACCCCTGTCAAGACTG No data
Right 1065355417 10:24835538-24835560 TGGGACGTCTGCCCATCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065355417 Original CRISPR TGGGACGTCTGCCCATCATT TGG Intergenic
No off target data available for this crispr