ID: 1065356479

View in Genome Browser
Species Human (GRCh38)
Location 10:24846693-24846715
Sequence GTGGCTCATGACGCTTCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065356474_1065356479 13 Left 1065356474 10:24846657-24846679 CCTCTCATGTGGGCTCTGGTCTC No data
Right 1065356479 10:24846693-24846715 GTGGCTCATGACGCTTCTGGAGG No data
1065356470_1065356479 24 Left 1065356470 10:24846646-24846668 CCATCAACATTCCTCTCATGTGG No data
Right 1065356479 10:24846693-24846715 GTGGCTCATGACGCTTCTGGAGG No data
1065356477_1065356479 -9 Left 1065356477 10:24846679-24846701 CCTTGCGGATGTCTGTGGCTCAT No data
Right 1065356479 10:24846693-24846715 GTGGCTCATGACGCTTCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065356479 Original CRISPR GTGGCTCATGACGCTTCTGG AGG Intergenic
No off target data available for this crispr