ID: 1065357870

View in Genome Browser
Species Human (GRCh38)
Location 10:24859956-24859978
Sequence CAGTCATATTTTAATTTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 226}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065357870_1065357873 6 Left 1065357870 10:24859956-24859978 CCCACCAAATTAAAATATGACTG 0: 1
1: 0
2: 2
3: 28
4: 226
Right 1065357873 10:24859985-24860007 TGCCATCCCAGTTTACTAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065357870 Original CRISPR CAGTCATATTTTAATTTGGT GGG (reversed) Intronic
900874011 1:5328535-5328557 TAATCATATTTTTATATGGTTGG + Intergenic
907317707 1:53583086-53583108 CACTCACATTTAAATGTGGTAGG + Intronic
908129695 1:61062722-61062744 CAAACATATTTTAATTTGTCAGG - Intronic
908655678 1:66385722-66385744 CAATCATATTTTGACATGGTTGG + Intergenic
909247150 1:73300664-73300686 CAGTAATATATTAGTGTGGTTGG + Intergenic
909308841 1:74119693-74119715 GAGTATTATTTTAATTTGGTGGG - Intronic
910362321 1:86425881-86425903 CAGTCATATTTTTATATGCATGG - Intronic
910662677 1:89690209-89690231 CAGATACATTTTTATTTGGTAGG + Intronic
910787830 1:91020590-91020612 CAGTAATATTGCATTTTGGTAGG - Intronic
911279557 1:95905881-95905903 CTGTCTTATTTTAATTTAGCTGG + Intergenic
911500146 1:98675672-98675694 CTGACAAATTTTAATTTGGTGGG - Intronic
911836490 1:102625468-102625490 CAGTCATCTTTTAATTTCCAGGG + Intergenic
915459735 1:156062673-156062695 AAGTCATATTTTATTTTGAGGGG + Intronic
917392558 1:174554806-174554828 AAGTCATTTTTAAATTTAGTTGG + Intronic
917763804 1:178196050-178196072 CATTTATATTTTCATTTGATAGG - Intronic
918222999 1:182453242-182453264 CAGTCAAATTTCAACTTGGTAGG - Intronic
918702524 1:187622895-187622917 AATACATATTTTAATTTTGTGGG - Intergenic
918942583 1:191020099-191020121 CAGTCATTTTTTAATTATATTGG - Intergenic
919499413 1:198317014-198317036 AAAGCATATTTTAATTTCGTAGG + Intronic
920774312 1:208921345-208921367 AAGTCATATATTTATTTTGTGGG - Intergenic
923470190 1:234283268-234283290 AAGCCAAATTTTAATTTTGTAGG + Intronic
1063591219 10:7397413-7397435 CCTTCATATTTTATTTTGATTGG - Intronic
1065357870 10:24859956-24859978 CAGTCATATTTTAATTTGGTGGG - Intronic
1066723039 10:38359479-38359501 CAGTCTTATATTAGTTGGGTGGG + Intergenic
1067848939 10:49743072-49743094 CAGCCATCTGTTGATTTGGTTGG + Intronic
1075301893 10:121332351-121332373 CAGTCATTTATTAATTTCTTGGG - Intergenic
1077729986 11:4720373-4720395 CAGAAATATTTTAATCTGGTGGG + Intronic
1077801993 11:5548524-5548546 CACTCATGTTTTTTTTTGGTTGG - Intronic
1079751607 11:24206341-24206363 CAGTGATATTTTCATTTAGGAGG - Intergenic
1080142171 11:28934929-28934951 CAGTTAGATTTTTATTTGGGAGG + Intergenic
1082044919 11:47717573-47717595 CAGTTAGATTTTTATTTGCTGGG - Intronic
1088259606 11:107931406-107931428 GAGTCATAATTTATTTTGTTTGG + Intronic
1089086966 11:115828418-115828440 CAATTATATCTTAATTTGGGAGG + Intergenic
1090426575 11:126611074-126611096 GAGTCAGATTTTAATGTGGGCGG - Intronic
1091318120 11:134630250-134630272 TAGTTCTATTTTAATTTGGGGGG - Intergenic
1091656748 12:2351664-2351686 CAGTGATCTTCTCATTTGGTTGG + Intronic
1092079390 12:5701989-5702011 TAGGAATATTTTAATTCGGTTGG - Intronic
1094281687 12:28747077-28747099 CATGGATATTTTAATTTAGTGGG + Intergenic
1095925456 12:47575094-47575116 CAGTCATATTTTGAAGTGCTTGG + Intergenic
1097970067 12:65623954-65623976 CGGTCATATTTTGAGATGGTTGG + Intergenic
1098678403 12:73319886-73319908 CACTCATATTTAAATTAGGTGGG + Intergenic
1098743543 12:74205626-74205648 CAGTCAGCTGTTAACTTGGTTGG + Intergenic
1099186261 12:79518616-79518638 CAGTAATATTTTGATCTGGTTGG + Intergenic
1099727769 12:86455706-86455728 AAGTCAAATATTAATTTTGTAGG + Intronic
1100917690 12:99444946-99444968 GAGTTATATTTTTATATGGTAGG - Intronic
1101010638 12:100445852-100445874 CAGTCATATTCTAATTTGCCTGG - Intergenic
1101484734 12:105143738-105143760 TAGTGATATTTTTATTTGGAGGG + Intronic
1104244472 12:127024480-127024502 CAGACACATTTTCATTTGCTGGG - Intergenic
1106319139 13:28622353-28622375 CAGGCCTATTTGTATTTGGTTGG - Intergenic
1106924901 13:34603667-34603689 CAGTTATTTTTTATTTTGGAAGG - Intergenic
1106993111 13:35447850-35447872 CAATCAGATTTTGATTTGTTGGG + Intronic
1109573764 13:64226741-64226763 CAGTCATATTTCTACATGGTTGG - Intergenic
1110121222 13:71883953-71883975 CAATCATATTTTAATTTACAGGG + Intergenic
1110174414 13:72538719-72538741 CCGTCATGTATTACTTTGGTAGG + Intergenic
1110209536 13:72955115-72955137 AAGTAATATTTTAATTATGTTGG + Intronic
1111279886 13:86008205-86008227 AAGTCAAATTTTTATTTGTTGGG - Intergenic
1112187842 13:97144993-97145015 CAGACAAAATTTAAATTGGTGGG - Intergenic
1112530001 13:100191718-100191740 CAGTCATATTTCAAATGGCTGGG + Intronic
1116053116 14:39828845-39828867 CAGGCATATTTTTATTTCTTTGG + Intergenic
1117940914 14:60963626-60963648 CAGTTAGATTTGAATTTTGTGGG + Intronic
1118122688 14:62863311-62863333 CAGTCATATTTAAACTGGGATGG - Intronic
1118565669 14:67137810-67137832 CAGTTTTAATTTAATTTGGATGG - Intronic
1119058622 14:71450233-71450255 CTGTCATATTTCTATTTGGAGGG + Intronic
1119811977 14:77529166-77529188 TTCTCATATTTTACTTTGGTTGG + Intronic
1122580395 14:102768175-102768197 CAGTGTTATTTTAATTATGTGGG + Intergenic
1124153918 15:27208724-27208746 CAGGCATTATTTTATTTGGTAGG - Intronic
1124352891 15:28971272-28971294 CAGGGAGATTCTAATTTGGTGGG - Intronic
1124389618 15:29242438-29242460 CTGTCATATTTTAATGTGCATGG + Intronic
1124468244 15:29959829-29959851 CAGTAAAATTTTACTTTGGGAGG - Intronic
1125185548 15:36925518-36925540 CAGTTTTGTTTGAATTTGGTTGG - Intronic
1125839702 15:42788203-42788225 CTTTGATATTTTAATTTTGTTGG + Intronic
1126511724 15:49483746-49483768 CAATTATATTTTATTATGGTGGG - Intronic
1126609072 15:50510368-50510390 CAATCAAGTTTTAATTTGGTTGG - Exonic
1129991634 15:79969308-79969330 CATACATTTTTTAATTTGTTAGG - Intronic
1131128254 15:89874898-89874920 GAGTCGTATTTTAAGTTGGTGGG + Intronic
1139974667 16:70800103-70800125 CAGTATTATTTTACTTTTGTGGG - Intronic
1140820024 16:78654862-78654884 CAGTCAAATTTTTTCTTGGTGGG + Intronic
1143413990 17:6732345-6732367 TAGTTATATTTTATTGTGGTCGG - Intergenic
1146292249 17:31616900-31616922 AGGTGATATTTCAATTTGGTGGG + Intergenic
1148014978 17:44515320-44515342 CAGTGATATTCTAAAATGGTAGG - Intergenic
1150162639 17:62911916-62911938 AAGTCATATTTTAAACTGGATGG + Intergenic
1150520656 17:65864265-65864287 GAGTCATATTTTAAGATGCTGGG + Intronic
1154256282 18:12783379-12783401 CAGTCAGATCTTAAATTAGTTGG + Intergenic
1154952188 18:21221236-21221258 CACAGAGATTTTAATTTGGTGGG + Intergenic
1155782491 18:29854385-29854407 CAGTCATATTTTATTTAAGAAGG - Intergenic
1156770890 18:40723239-40723261 CGATCATGTTTTAATTAGGTTGG - Intergenic
1157018932 18:43755744-43755766 CAGTCATATTTTAAAATACTAGG - Intergenic
1157968376 18:52236604-52236626 CAGCCATATTTTACCTTGGATGG - Intergenic
1158624003 18:59056350-59056372 CAGGCACATCTTAATATGGTGGG + Intergenic
1159074674 18:63666805-63666827 ATGTCCTATTTTAATTTTGTTGG + Intronic
1159358192 18:67364187-67364209 CAGTCAAATTTTAATTTAATTGG + Intergenic
1160170649 18:76550382-76550404 CAATTATATTTTATGTTGGTAGG + Intergenic
1160303831 18:77712686-77712708 AAGTCATATCTTAATTTTATTGG - Intergenic
1162727437 19:12698484-12698506 CAGTAAGATTTTATTTTGGCTGG + Intergenic
1164862693 19:31574917-31574939 CGTTCATAATTTAATTTGGGGGG + Intergenic
925760559 2:7180412-7180434 CAACCATTTTTTTATTTGGTTGG - Intergenic
925764505 2:7218047-7218069 CAATAATTTTTTAATGTGGTTGG + Intergenic
926822804 2:16871710-16871732 CAGTCATATTTTCTTTTGTTTGG - Intergenic
926979063 2:18547706-18547728 CATTCTTATTTTGAATTGGTTGG + Intergenic
927529069 2:23776946-23776968 CAGTCATATTTTAAGGTACTGGG - Intronic
929464263 2:42130679-42130701 AAGTCATATTTTAATTTAGTTGG - Intergenic
930756481 2:54978827-54978849 CAGTCAGATTTTAAATTTATGGG - Intronic
931714424 2:65017863-65017885 CAGTCATATTTTAAGTATCTTGG + Intronic
931785401 2:65613522-65613544 CTGTCAGATTTTCATATGGTTGG + Intergenic
932150503 2:69366924-69366946 CAAACATATTTAAATTTGCTGGG + Intronic
934907054 2:98214256-98214278 CACTCATAATTGAATTTTGTGGG + Intronic
935846780 2:107174492-107174514 AAGTCATATTTTGATTGTGTCGG - Intergenic
937057247 2:118949441-118949463 GAGTCATAGTTTGATTTTGTAGG + Intronic
937410476 2:121670373-121670395 CTGTCATATCTTGAGTTGGTTGG - Intergenic
938602735 2:132859226-132859248 CTGTTTTATTTTAATTTGGGGGG + Intronic
939215111 2:139226875-139226897 TATGCATATTTTAATTTGGGGGG + Intergenic
940150944 2:150599740-150599762 AAGTCATATTTTCATTTTCTGGG + Intergenic
940743816 2:157544368-157544390 TAGTTATATTTTAATTTATTAGG - Intronic
943426521 2:187743791-187743813 CAGTCATATTTTAATATACTGGG + Intergenic
944231503 2:197398304-197398326 CAGTCAAATTTCAATTTGGATGG - Intronic
945097536 2:206233652-206233674 CTGTCATATTTGAACTTGGGTGG + Intergenic
945401808 2:209391102-209391124 CTAACATATTTTAATTTGTTTGG + Intergenic
946724445 2:222648112-222648134 AAGACATACTTTAATTTGGTGGG - Intronic
946796715 2:223362189-223362211 CAGGGCTATTTTTATTTGGTGGG + Intergenic
946804235 2:223454104-223454126 CAGTCATATTTTAAAGTACTGGG - Intergenic
947560218 2:231143013-231143035 CAGATATTTCTTAATTTGGTAGG - Intronic
1170863649 20:20133100-20133122 CAGTGATATGTTAATTTAATTGG + Intronic
1173395404 20:42674907-42674929 CTTTCATATATTAATTGGGTTGG - Intronic
1177311806 21:19406572-19406594 CAGTTATTTTTTAATTAGATGGG - Intergenic
1178837108 21:36108047-36108069 GAGTCATAGTTTGATTTTGTAGG - Intergenic
1181402452 22:22659361-22659383 CATTCATATTTTTTTTTGGGGGG + Intergenic
949564459 3:5232108-5232130 AAATTATCTTTTAATTTGGTGGG - Intergenic
949667735 3:6360263-6360285 CAGTCATAATTTTACTTGGTTGG - Intergenic
952145774 3:30530634-30530656 CGATCAGATTTTAATTGGGTGGG + Intergenic
952775417 3:37041270-37041292 CTGTCACTTTTTAATTTGTTAGG + Intronic
956269460 3:67434650-67434672 CAGTAATATTTTATACTGGTTGG + Intronic
956577649 3:70771470-70771492 CAGTCATATTCTAAGTTACTGGG - Intergenic
956790596 3:72677201-72677223 CAGACATATTTGACTTTGTTAGG - Intergenic
957496408 3:80996778-80996800 CAAGCATATTATATTTTGGTGGG - Intergenic
957975283 3:87435330-87435352 CAGCCATTTTTTTATTTGATGGG - Intergenic
958537404 3:95422555-95422577 TAGTAACATTTTAATTTGCTGGG - Intergenic
958772042 3:98436716-98436738 CAGTTATGTTTTAATTTTGCCGG + Intergenic
958967851 3:100578991-100579013 CAGTCATATTTTCTTGTGCTAGG + Intergenic
959357637 3:105353284-105353306 CAGTTGTATTTAATTTTGGTAGG + Intergenic
959783320 3:110263139-110263161 CAGTCATAGGTTAATTAGTTGGG + Intergenic
960016375 3:112893828-112893850 CAGTTAAATTTTAATTTGTATGG + Intergenic
960206081 3:114900689-114900711 CAGTCATATTTGTATTAGGAAGG - Intronic
961069469 3:123908516-123908538 CAATGATATTTTAAGTTGGTGGG - Intronic
962228963 3:133643109-133643131 CATTCAAATTAGAATTTGGTTGG - Intronic
962672195 3:137720177-137720199 CCGTGAAATTTAAATTTGGTGGG + Intergenic
962931303 3:140039866-140039888 CTGTCATCTTTTAATCTAGTTGG - Intronic
963597885 3:147351022-147351044 CTTTCATATTTTATTTTGGCTGG + Intergenic
963619885 3:147593418-147593440 CAGTAAGTTTTTAATTTGTTGGG + Intergenic
964586473 3:158311217-158311239 AATTCATAGTTTAATATGGTAGG - Intronic
965914085 3:173819742-173819764 CAGATATTTTTTAATTTGGGTGG - Intronic
967224847 3:187281498-187281520 CAGTGATATTTTAAGTTTCTTGG + Intronic
967501427 3:190202663-190202685 AAGTGACATTTTAAGTTGGTGGG + Intergenic
970729352 4:19084585-19084607 CATTGAGATTATAATTTGGTTGG + Intergenic
970775121 4:19664660-19664682 CATTAATTTTTTCATTTGGTAGG - Intergenic
971588733 4:28439391-28439413 ATGTCATATTTTAAGTTGGTTGG - Intergenic
974128514 4:57724961-57724983 CAGTCCTGTTTTATTTTTGTTGG + Intergenic
977107360 4:92904696-92904718 CATTCATTTCTTAATTTGTTTGG - Intronic
977422852 4:96825233-96825255 CAGTGATATTCTAATTTCCTTGG + Intergenic
977567050 4:98591115-98591137 CAGACATATTTTTTTTAGGTAGG + Intronic
977759096 4:100709662-100709684 CAATCTTTTTTTAATTTGGTAGG - Intronic
978701644 4:111653698-111653720 CAGTCATATTCTAATTTCTCAGG - Intergenic
979039977 4:115777329-115777351 GAGTCATATATTACTTTGCTTGG - Intergenic
979963116 4:127045230-127045252 GATTCCTACTTTAATTTGGTAGG - Intergenic
980110147 4:128628051-128628073 TAGGAATATTTTAATTTGGTTGG + Intergenic
980394168 4:132187504-132187526 CATTTATATTTTAATTTTATAGG + Intergenic
980472039 4:133264531-133264553 CAGTTTTATTTTTTTTTGGTGGG + Intergenic
983759759 4:171391188-171391210 CACTCATATTTGAAAGTGGTGGG - Intergenic
984265149 4:177489282-177489304 CGGTCCTATTTCAATTTGGTAGG - Intergenic
984365953 4:178800479-178800501 CAGGTATATTTTTATTTGATGGG + Intergenic
984392643 4:179156539-179156561 AAGTTATATTTTAATTTTTTAGG + Intergenic
984457991 4:179995704-179995726 AAATCATATATTATTTTGGTAGG - Intergenic
985893538 5:2735234-2735256 CAGTCACATTTAACTTTTGTTGG - Intergenic
987479669 5:18437730-18437752 CAGTCACATATGAATTTGGTGGG - Intergenic
987695148 5:21318698-21318720 CATTTAAATTTTAATTTAGTTGG + Intergenic
988148780 5:27348082-27348104 CAGTCATCTTTTGCTATGGTTGG + Intergenic
988901445 5:35736961-35736983 CAGTCTGCTTTTACTTTGGTTGG + Intronic
988984928 5:36608408-36608430 TAGTCATATTTTACTTTTCTAGG - Exonic
991998536 5:72412783-72412805 CTGTAATATTTTAAATAGGTTGG + Intergenic
993385352 5:87255943-87255965 CAGTCATATTTGTATTTATTTGG - Intergenic
993402480 5:87471262-87471284 CAGACATATTTTTTTTAGGTAGG - Intergenic
993602530 5:89946368-89946390 CATTCATATTCAAATTTGGGAGG + Intergenic
993641366 5:90409855-90409877 CAGTTCTATTTTCATTGGGTAGG + Intergenic
994019782 5:95009419-95009441 CATTTATATTTTCATTAGGTTGG - Intronic
996104913 5:119489485-119489507 CAGCCACATTTTCATTTGGTAGG - Intronic
998437900 5:142128872-142128894 CTGTCATCTTTTACTATGGTGGG + Intronic
998950150 5:147385568-147385590 CAGTGATATTTTAAATAAGTAGG - Exonic
999427634 5:151501205-151501227 CAGTCATTTTTTAATCTGAATGG + Intergenic
1001370069 5:171191008-171191030 CAGTCATATTTTTAATTACTAGG + Intronic
1003956018 6:11165573-11165595 TGATCATATTCTAATTTGGTGGG + Intergenic
1004265680 6:14146482-14146504 CAATAATATTTTCAGTTGGTTGG + Intergenic
1004966975 6:20863105-20863127 CATGCAAATTTTATTTTGGTGGG + Intronic
1005555742 6:26981152-26981174 CATTTAAATTTTAATTTAGTTGG - Intergenic
1007484855 6:42173942-42173964 CAGTCATTTGTTTATTTGATAGG + Intronic
1007906009 6:45461356-45461378 CAGAGATATTTTGATTTGGTGGG + Intronic
1008682732 6:53891250-53891272 AAGTCATGTTTTTTTTTGGTAGG + Intronic
1008839420 6:55882556-55882578 GATTTATATTTCAATTTGGTAGG - Intergenic
1009700883 6:67178839-67178861 CTGTCGTAATTTAATTTGCTTGG + Intergenic
1011116868 6:83903457-83903479 CAGTGATATTGTAGTTTTGTGGG + Intronic
1011859657 6:91738892-91738914 CTGTCAGATTATAATTTGGGTGG - Intergenic
1011910302 6:92427335-92427357 CTGTCATATTATAAATTTGTGGG + Intergenic
1015373574 6:132483946-132483968 CAGTCATCTTCTATTTTGATTGG + Intronic
1016759835 6:147724999-147725021 CAGTCATATTTTTTGTTGATAGG + Intronic
1017205832 6:151803820-151803842 CAGTGAGATTTTAATCTGGGTGG + Intronic
1017308836 6:152953460-152953482 CAGTCTTTTTTTTTTTTGGTGGG + Intergenic
1017338927 6:153297549-153297571 CAGCAATGTTTTAATTTGCTAGG + Intergenic
1017690941 6:156963109-156963131 TAGTTATAGTTTATTTTGGTAGG + Intronic
1017902205 6:158727953-158727975 AAGTGATATTTTACTTAGGTTGG + Intronic
1021135072 7:16955457-16955479 CAGCCATACTTAAATTTTGTTGG + Intergenic
1024436642 7:49364368-49364390 GAGTCATGTATTAATTTGCTAGG + Intergenic
1025190924 7:56895255-56895277 CAGTAAAATGTTCATTTGGTTGG + Intergenic
1025621908 7:63180784-63180806 GATTTTTATTTTAATTTGGTGGG - Intergenic
1025681019 7:63681674-63681696 CAGTAAAATGTTCATTTGGTTGG - Intergenic
1027771583 7:82413978-82414000 CAGTCAAAATTTTATTTAGTTGG + Intronic
1028072020 7:86461786-86461808 GAATCATAATTTTATTTGGTAGG + Intergenic
1030509963 7:110471881-110471903 CAGTTGTATTTTCATTAGGTAGG - Intergenic
1031263087 7:119547980-119548002 CAGTTTTATTTTAATTTGAAGGG - Intergenic
1031346446 7:120672737-120672759 CAGTCATATTTTAAAATACTGGG - Intronic
1031914558 7:127550852-127550874 CATTCATGTCTTAATTAGGTGGG - Intergenic
1032876185 7:136040871-136040893 CTGGCATATTTACATTTGGTGGG - Intergenic
1033469231 7:141629415-141629437 CAGTCAAATTTTGAGATGGTTGG - Intronic
1034777208 7:153839273-153839295 TTGTCATCTTTTAATTTGGTGGG + Intergenic
1036577103 8:10038117-10038139 CAGTCACACTGTGATTTGGTAGG + Intergenic
1036959141 8:13224970-13224992 CAGTCATTTTTTTCTTTGCTAGG + Intronic
1037528552 8:19751583-19751605 CAGTTATATATTGATATGGTTGG + Intronic
1039671126 8:39600366-39600388 GATTTATATTTTAATTTGATTGG + Intronic
1040393354 8:46969591-46969613 CTGACATATTTGAATTTGATGGG + Intergenic
1041435323 8:57832606-57832628 CAGTCATATTTTGAGTTGCTGGG + Intergenic
1042318354 8:67448923-67448945 AAGTAATGTTTTAATTTGGTAGG - Intronic
1042788835 8:72580873-72580895 AAGACATATTTTAATTCTGTTGG - Intronic
1043074888 8:75685459-75685481 CAGTCATATCTTATTTTTCTTGG - Intergenic
1044937437 8:97306634-97306656 CAGTCATTGTTTATTGTGGTAGG - Intergenic
1047077175 8:121417289-121417311 CAGTGATATTTTAAAATGGGAGG + Intergenic
1048196724 8:132337553-132337575 CATTCATATATTCATGTGGTGGG - Intronic
1048885766 8:138908130-138908152 CTGTCATATTTTATTTTGCCTGG - Intronic
1050409454 9:5347627-5347649 CAGTTCTATTTTAATTTTCTTGG - Intergenic
1050781315 9:9339968-9339990 CAAACATACTTTAATTGGGTAGG + Intronic
1051208310 9:14713522-14713544 GAGTCAGATTTTCATTTTGTGGG - Intergenic
1052524473 9:29596336-29596358 TTGTCTTATTGTAATTTGGTTGG + Intergenic
1054965202 9:71017436-71017458 TAGTCATTTTTTAGTTTTGTGGG - Intronic
1059156445 9:111993024-111993046 CAATAGTATTTTAATTTGGTGGG - Intergenic
1059426470 9:114223981-114224003 CAGTCACATTGGAACTTGGTGGG + Intronic
1186052263 X:5610446-5610468 CAGTCAACTTTTAATTAGCTTGG - Intergenic
1186814608 X:13224194-13224216 CATTCCTATTTCAATCTGGTAGG - Intergenic
1187020037 X:15371557-15371579 CATTCATATTTGAATTTCTTTGG + Intronic
1187708004 X:22026341-22026363 CAGCCATCATTTAATTTGGGGGG - Intergenic
1188895374 X:35660819-35660841 CAGTTAGACTTTAATTTGCTTGG + Intergenic
1191721103 X:64229626-64229648 CAGTCACATTTTAATATAATTGG - Intronic
1196121936 X:112060757-112060779 CAGTCATATATTATTTTGGTGGG - Intronic
1196940419 X:120770245-120770267 TAGTGACATTTTAATTTGGGAGG + Intergenic
1198247246 X:134842152-134842174 TACTCATATTTTAATTGGGTTGG + Intronic
1198961135 X:142184671-142184693 CTGTAATGTTTTAATTTTGTTGG - Intergenic
1199208009 X:145172187-145172209 CAATCAAATTTTTATTTGGGGGG - Intergenic
1199419821 X:147631954-147631976 CAGTCATATTCTGAGTTGCTGGG + Intergenic
1199523424 X:148764543-148764565 ATGTCATATTGTAATTTTGTTGG + Intronic
1201242716 Y:11974173-11974195 CAGTCATATTTTGAGTTCCTGGG + Intergenic
1201306194 Y:12552587-12552609 AAGTCAAACTTTAATTGGGTGGG - Intergenic
1201666514 Y:16462981-16463003 GAGTCAAATGTTAATTTTGTTGG - Intergenic