ID: 1065358538

View in Genome Browser
Species Human (GRCh38)
Location 10:24867250-24867272
Sequence CAGAGTTAAATGAAGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 383
Summary {0: 1, 1: 1, 2: 0, 3: 27, 4: 354}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065358538_1065358546 26 Left 1065358538 10:24867250-24867272 CCTCCCTCCTTCATTTAACTCTG 0: 1
1: 1
2: 0
3: 27
4: 354
Right 1065358546 10:24867299-24867321 CCTTCTCTTCCACCCTAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065358538 Original CRISPR CAGAGTTAAATGAAGGAGGG AGG (reversed) Intronic
900326786 1:2112129-2112151 CAGAGGTGAAGGAAGGAGAGGGG - Intronic
901490250 1:9593023-9593045 CAGAGTCAAGTTAAGGACGGAGG + Intronic
901524344 1:9810078-9810100 GAGAGAGAAAGGAAGGAGGGAGG + Intronic
902328189 1:15716522-15716544 CAGACATAAATGATGGAGGGAGG + Intronic
902750280 1:18503836-18503858 GAGAGAGAAACGAAGGAGGGAGG + Intergenic
903668706 1:25022912-25022934 CAGAGAGAAGTGGAGGAGGGAGG - Intergenic
904003646 1:27351918-27351940 GAGAGTGAAATGGAGGTGGGCGG + Intronic
904272050 1:29356545-29356567 CAGAGCTAAGAGAAGGAAGGAGG + Intergenic
905506201 1:38481492-38481514 CAGAGTGGGATGAAGGAAGGTGG - Intergenic
908475491 1:64483868-64483890 CAGAGTTATATGCAAGGGGGGGG - Intronic
908575769 1:65458280-65458302 CAGATCTAAATGAAGATGGGAGG - Intronic
909279308 1:73728462-73728484 CAGAGTTATATGGAGTTGGGTGG + Intergenic
909600497 1:77456576-77456598 CAGACTTAAAAGAACGAGGATGG + Intronic
909969278 1:81960239-81960261 CAGAGTTAAATGATGCACTGTGG - Intronic
911002372 1:93180013-93180035 CTGGGTTAAAGGAAGGAGGCTGG + Intronic
911333556 1:96553838-96553860 AAGAGTTAAATGAATGAGTGGGG + Intergenic
912017218 1:105055800-105055822 TAGAGTTAAATGTAGAAGGTAGG - Intergenic
912222636 1:107695795-107695817 CAGTGTTAAATGAAAGAGAAAGG + Intronic
913513323 1:119581983-119582005 CTGAGGTCAATGAAGGAAGGAGG - Intergenic
914939237 1:152007430-152007452 CAGAGATCAAAGAAGGAGGCTGG - Intergenic
915626799 1:157118812-157118834 CAGGGTTGAAGGAAGGTGGGAGG + Intergenic
915783618 1:158582408-158582430 CAGAGATAGATGAGGTAGGGTGG - Intergenic
916811525 1:168309618-168309640 CAGAGTTAAGTGTAGCATGGGGG + Intronic
917009848 1:170458371-170458393 GAGGGTTAGATGAAGCAGGGTGG - Intergenic
917527341 1:175800662-175800684 CAGATTTGACTGCAGGAGGGTGG + Intergenic
917646904 1:177038164-177038186 AGGAGTTAGCTGAAGGAGGGAGG - Intronic
917745958 1:178007403-178007425 CAGAGCAAAATGAGGGAGGCAGG + Intergenic
917931373 1:179824892-179824914 CAGAGTTAAGAGAAGGGCGGGGG - Intergenic
918820963 1:189253724-189253746 AATAGTTAACAGAAGGAGGGGGG + Intergenic
919354018 1:196498428-196498450 CAGAATTAGAAGAAAGAGGGAGG - Intronic
920278211 1:204824290-204824312 CAGCATTAAGGGAAGGAGGGAGG - Intergenic
921233214 1:213095251-213095273 CAGAGTAAAAAGAAAGAGAGAGG - Intronic
921294384 1:213688388-213688410 CAGAGATAGTTCAAGGAGGGTGG - Intergenic
922314596 1:224432772-224432794 CAGAATGAAATGAAGGGGGGAGG - Intronic
922552335 1:226505009-226505031 CAGAGGGAAAGGAAGGAGAGAGG + Intergenic
922565048 1:226596344-226596366 CAGAGGTAAATTCAGGAGAGGGG - Intronic
923260869 1:232266709-232266731 CAGAGTTAAATAGTGAAGGGAGG + Intergenic
923990124 1:239427003-239427025 CAGAGGTGAGTGAAGGAGGTGGG + Intronic
924091608 1:240507320-240507342 GAGAGGTAAAGGAGGGAGGGAGG - Intronic
924365634 1:243290450-243290472 TTGAGATCAATGAAGGAGGGTGG - Intronic
1064302500 10:14134768-14134790 CAAAGATAAATGAAGTTGGGAGG + Intronic
1064358316 10:14639843-14639865 CAGTGTTAGCTGAAGGAGGAAGG - Intronic
1064428611 10:15252360-15252382 CAGAGTTCAGTGAAGGTGGATGG - Intronic
1064576238 10:16748765-16748787 GAGACTTAAAGGAAGGAGGGAGG - Intronic
1065358538 10:24867250-24867272 CAGAGTTAAATGAAGGAGGGAGG - Intronic
1067013883 10:42740928-42740950 GAGACTTAAAGGAAGGAGGGAGG + Intergenic
1069841554 10:71342661-71342683 CTGAGTAGAATGAAGGAGAGAGG - Intronic
1070335487 10:75451515-75451537 CAGAGCTAAATAAATGAGAGGGG + Intronic
1071254008 10:83850482-83850504 CAGAGGAAAAGGAAGGAGCGAGG - Intergenic
1071708130 10:88021607-88021629 CAGAGTTTCATGAGTGAGGGAGG + Intergenic
1074275760 10:112000321-112000343 CAGAGGTAAATGAAGGGATGTGG + Intergenic
1074816563 10:117145962-117145984 GAGAGAGAAAGGAAGGAGGGAGG + Intergenic
1074957786 10:118409363-118409385 CAGAGGCAAAGGATGGAGGGAGG + Intergenic
1075696113 10:124436729-124436751 CAGAATGAGATGAAGGAAGGAGG - Intergenic
1076058612 10:127395660-127395682 CAGACTTAGAGGAGGGAGGGTGG + Intronic
1076676768 10:132151176-132151198 CATAGATAAATTATGGAGGGTGG - Intronic
1079314996 11:19399984-19400006 CACAGTTAAAGGCAGGTGGGAGG + Intronic
1079320092 11:19444580-19444602 CAGAGTTCAATGATAGAGTGAGG - Intronic
1079523276 11:21354346-21354368 GAGAGTAGAAAGAAGGAGGGAGG - Intronic
1080237629 11:30090156-30090178 GAGACTTAAATGGAGGAGAGAGG - Intergenic
1080886655 11:36374461-36374483 CAGAGTTGAATGAGGGAGACTGG + Intronic
1085822192 11:79804805-79804827 CAGGGTTAAATGGATTAGGGCGG + Intergenic
1086162205 11:83734420-83734442 GAGAGAGAAAGGAAGGAGGGAGG - Intronic
1087613941 11:100467114-100467136 AAGATTTAGATGAAGGAGGAGGG - Intergenic
1088186945 11:107181094-107181116 CAGAGCTAGAGGAAGGAGGAGGG + Intergenic
1088596100 11:111441458-111441480 GAGAGTTGAAAGAAGAAGGGTGG - Intronic
1091415372 12:278267-278289 CAGAGTAAACTGACAGAGGGGGG + Intergenic
1092217586 12:6693997-6694019 GAGAGTGGAAGGAAGGAGGGAGG + Exonic
1092288265 12:7142522-7142544 AAGAGTCAAAACAAGGAGGGAGG - Intronic
1092786587 12:12032365-12032387 CAGAGTAAAATGCTGGTGGGAGG - Intergenic
1093158852 12:15720935-15720957 CAGAGATTAATGCAAGAGGGTGG - Intronic
1093850545 12:24031526-24031548 CAGAGGTGGATGAAGGAGGCTGG + Intergenic
1094050027 12:26209005-26209027 AAGAATAAAATGAAGGAGGGTGG - Intronic
1094196194 12:27752215-27752237 CTGAGATGAATGAAGGAGGAGGG + Intronic
1095539789 12:43296156-43296178 CAGAAATGAATGAAGGAAGGTGG - Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096900167 12:54869227-54869249 CTTAATTAATTGAAGGAGGGTGG - Intergenic
1099782481 12:87215314-87215336 CTGAGTTAAGTGAGGGTGGGAGG - Intergenic
1099964305 12:89429023-89429045 CAGAGTTCAATGAATGATTGGGG - Intronic
1100571290 12:95845403-95845425 AAGGGTTAAATGGAGGAAGGAGG - Intergenic
1102194725 12:111016900-111016922 CAGAGGTAAAAGAGAGAGGGAGG - Intergenic
1104472083 12:129037298-129037320 CACAGTCACGTGAAGGAGGGTGG - Intergenic
1104508837 12:129357360-129357382 AAGAGAGAAAGGAAGGAGGGAGG + Intronic
1105693853 13:22869428-22869450 ATGAGTTAAATAAAGGAGGGTGG - Intergenic
1105779195 13:23691561-23691583 CAGAGTGACATGAAAGATGGGGG + Intergenic
1110540270 13:76699984-76700006 CAGATATAAAGAAAGGAGGGTGG + Intergenic
1110838351 13:80110845-80110867 CAGAGCTAGATGAAGGAGCTAGG + Intergenic
1112582936 13:100691919-100691941 CAGAGATAAATGAATCATGGGGG + Intergenic
1113094143 13:106645908-106645930 GAGAGAGAAAGGAAGGAGGGAGG - Intergenic
1114190785 14:20438097-20438119 CAGAGCTACATGAAGGGTGGTGG - Intergenic
1114416525 14:22548516-22548538 ATGAGTTGAATGAAGGAGGCAGG + Intergenic
1114528968 14:23383379-23383401 AAGAGTAAAATGATGGAGGAGGG - Intronic
1115163574 14:30423295-30423317 AATAGTAAAGTGAAGGAGGGTGG - Intergenic
1115227742 14:31121932-31121954 CAGAGTTAAGTGGAAGAGTGAGG - Intronic
1117474266 14:56078045-56078067 CAGAATTACATGCAGCAGGGAGG + Intergenic
1118329657 14:64805489-64805511 TAGTGTTAAGTGAAGGAGGTGGG - Intronic
1118348073 14:64954230-64954252 AAGAGTGAAGAGAAGGAGGGAGG + Intronic
1118677150 14:68199636-68199658 CGGAATGAGATGAAGGAGGGAGG - Intronic
1118856875 14:69629852-69629874 CTGCCTTAAATGAGGGAGGGTGG + Intronic
1119646022 14:76349150-76349172 CAGAGTTAATTAAAGCAGCGAGG + Intronic
1120421918 14:84298317-84298339 CAGAGGAAAAGGTAGGAGGGAGG + Intergenic
1121380675 14:93463175-93463197 GAGAGTTTCAAGAAGGAGGGAGG + Intronic
1122781756 14:104146736-104146758 CAGAGTTAAACCAAGGAGACGGG + Intronic
1122863839 14:104594705-104594727 CAGAGTCCAAGGAAGGAGGCAGG - Intronic
1123875868 15:24623038-24623060 CAGAATTAAATGAATCAGGCTGG - Intergenic
1124947203 15:34280019-34280041 CAGAGTGAAATGATTGTGGGTGG + Intronic
1125106165 15:35973993-35974015 CAGATTGAAGTTAAGGAGGGAGG - Intergenic
1126304843 15:47244080-47244102 CATATTTGAATGAAGGAGAGAGG + Intronic
1127377416 15:58397946-58397968 CTCAGTTAACTGAGGGAGGGAGG - Intronic
1127517917 15:59714201-59714223 CAGAGTGAAATGACTAAGGGAGG - Intergenic
1128732532 15:70030911-70030933 CAGAGATACAGAAAGGAGGGAGG - Intergenic
1128927918 15:71675656-71675678 GAGGGTTAGATGAAGGAGGTGGG - Intronic
1129115518 15:73363361-73363383 CAGAGTTAGATGCCTGAGGGGGG - Intronic
1130060461 15:80566244-80566266 CAGAGTTAGAGGAAGAAGGCAGG - Intronic
1130987539 15:88854605-88854627 CAGGGAGAAAGGAAGGAGGGAGG - Intronic
1131018708 15:89079775-89079797 CTGAGCTAGAAGAAGGAGGGAGG - Intergenic
1131029835 15:89177324-89177346 CACTGTAAAATGAAGGAGGTGGG + Intronic
1131035228 15:89217759-89217781 CAGAGTGAAATGATGGAAAGAGG - Intronic
1131649395 15:94382388-94382410 CAGACATAAAGGAAGGAGTGAGG - Intronic
1132022295 15:98373138-98373160 CAGGGATAAAGGAAGGAGGGTGG + Intergenic
1133122024 16:3614637-3614659 GAGAGTTAGATAAAGGGGGGAGG + Intronic
1133290352 16:4716567-4716589 CAGAGTCAAAAGTAGGATGGGGG - Intronic
1133444870 16:5851412-5851434 CAGAGGAAAATTAAGGAGGAGGG - Intergenic
1133461906 16:5994047-5994069 AAGAGTTAAATGATGCAGGATGG + Intergenic
1133560831 16:6948705-6948727 CATAGTCAAATGATGGAGGAGGG - Intronic
1135200868 16:20436762-20436784 CATAGTTGAAAGCAGGAGGGTGG - Intronic
1135218247 16:20591105-20591127 CATAGTTGAAAGCAGGAGGGTGG + Intergenic
1135464149 16:22670781-22670803 CAGTTTTGAATGAGGGAGGGAGG + Intergenic
1135686719 16:24503702-24503724 CAGAGATAAATGAAGGAGGGAGG + Intergenic
1136024930 16:27463128-27463150 CAGAGTTACAGGAAGCAAGGGGG - Intronic
1136061414 16:27729215-27729237 GAGAGCTAAGTGATGGAGGGAGG - Intronic
1137445042 16:48526525-48526547 CAGAGTTAAATGGAGGGTGCTGG - Intergenic
1137877145 16:52007411-52007433 GAGAATTAAATGAAGGACTGAGG - Intronic
1138830487 16:60368802-60368824 GAGAGTTAAATGAAGTAATGAGG + Intergenic
1138943847 16:61823307-61823329 AAGAGTTAAAGGAGGGAAGGTGG - Intronic
1139070857 16:63380876-63380898 TGGAGTTAAATGGGGGAGGGAGG + Intergenic
1139239514 16:65376611-65376633 CAGAGTCTAAAGAAAGAGGGAGG + Intergenic
1142985197 17:3691090-3691112 CAGCGTTACCTGAAAGAGGGCGG + Intronic
1143111945 17:4557965-4557987 CAGAGTTATCTGAAGCATGGGGG - Exonic
1143403494 17:6660685-6660707 CAGAGGGAGATGAAGGAGAGGGG + Intergenic
1143674148 17:8418670-8418692 GAGAGAGAGATGAAGGAGGGAGG - Intronic
1145837498 17:27965633-27965655 CTGAGTTGAAGGAAGGAGAGAGG - Intergenic
1146834043 17:36095477-36095499 GAGAGAGAAAGGAAGGAGGGAGG - Intergenic
1148999170 17:51739478-51739500 CAGAGTCAAGTGGAGGAGGATGG + Intronic
1149282424 17:55122500-55122522 CAGAGATAAATGAAGGAATGTGG + Intronic
1149515207 17:57275923-57275945 CACAGAGAACTGAAGGAGGGAGG - Intronic
1149865214 17:60147835-60147857 CAGAGTAAGAGGAAGGAGGCTGG + Intergenic
1149985728 17:61345491-61345513 CATGGAAAAATGAAGGAGGGAGG + Intronic
1150051897 17:61972380-61972402 CAAAATTAAATGAAAAAGGGAGG - Intronic
1150879735 17:69010494-69010516 AAGAGACAAATGAGGGAGGGAGG + Intronic
1153473582 18:5472459-5472481 CAGAGATCCATGGAGGAGGGTGG + Intronic
1154010466 18:10569608-10569630 CAGAGGTACATGAAGTTGGGAGG + Intergenic
1154111726 18:11574824-11574846 GAGAGAGAAAGGAAGGAGGGCGG + Intergenic
1154154311 18:11932002-11932024 CAGCTTTAAATAAAGAAGGGCGG + Intergenic
1156053925 18:32974677-32974699 CAGAGCTAAAGGGAAGAGGGAGG + Exonic
1156488314 18:37480715-37480737 CAAAGTTGAAAGAGGGAGGGAGG + Intronic
1157327352 18:46678687-46678709 CAGGGAGAAAGGAAGGAGGGAGG + Intronic
1159509313 18:69376066-69376088 CTCAGTTAAAGGAAGGAGGGTGG + Intergenic
1163973087 19:20819458-20819480 CAGAGGAGAATGAAGGAAGGAGG + Intronic
1164692356 19:30220711-30220733 CAGATTTAAAAGCAGCAGGGAGG - Intergenic
1165469677 19:35996026-35996048 CAGAGTTAAATACAGGAGAGGGG - Exonic
1166455053 19:42933854-42933876 CAGAGTTACATGAGGTGGGGTGG + Intronic
1166464847 19:43023139-43023161 CAGAGTTACATGAGGTGGGGTGG + Intronic
1166484606 19:43202355-43202377 CAGAGTTACATGAGGTGGGGTGG + Intronic
1166491729 19:43266236-43266258 CAGAGTTACATGAGGTGGGGTGG + Intronic
1167434738 19:49472949-49472971 AAGATTTAAATGAAGCAGAGAGG - Intronic
1167801455 19:51745515-51745537 CCTAGGTAAATGAAGGAGGAGGG - Exonic
1168149678 19:54438879-54438901 CAGAGTGGACTGAAGGAGAGGGG + Intergenic
925199224 2:1952824-1952846 CAAAGGTAAGGGAAGGAGGGAGG - Intronic
925222879 2:2156670-2156692 CAGAGGTGAAGGAAGGAAGGAGG + Intronic
926588410 2:14714459-14714481 CAGAGATAAATGAGGCATGGAGG + Intergenic
927103129 2:19802957-19802979 GAGAGTTTAATGGAGGGGGGGGG - Intergenic
929240151 2:39646112-39646134 CACAGTTAATTGAAGGGTGGTGG - Intergenic
929682414 2:44004821-44004843 TTGAGTTAAATGAAGGCAGGGGG + Intergenic
930654359 2:53993328-53993350 AGGAGTGAAATGAAGGAAGGAGG + Intronic
930887782 2:56347703-56347725 CAGAGTGAACTGGAGGAGGGTGG + Intronic
932486843 2:72089309-72089331 GAGAGTGGAAGGAAGGAGGGAGG + Intergenic
934903536 2:98179751-98179773 AAGAGAGAAAGGAAGGAGGGAGG - Intronic
937689434 2:124738235-124738257 CAGAGTGAAAAGAAAGAGGGAGG - Intronic
939553902 2:143650592-143650614 CAGAGCCAAATGAAGGAGACAGG + Intronic
939895337 2:147784791-147784813 CACAGTTCAATGAAGGTTGGTGG + Intergenic
943631740 2:190261377-190261399 CAAAGTTAATTGAAAGAGGTGGG - Intronic
943686228 2:190821222-190821244 CAGACTGAAATGAAAGAGGAAGG - Intergenic
946063871 2:216969265-216969287 GAGAGAGAAAGGAAGGAGGGAGG - Intergenic
946200784 2:218069663-218069685 CGGAGGTAAATGAGGGAGGTGGG - Intronic
946281210 2:218666833-218666855 CAGAATAGAATGAAGGTGGGTGG - Intronic
946408105 2:219502938-219502960 CATAAATAAATAAAGGAGGGAGG - Intronic
946876717 2:224136847-224136869 CTGATATAAATGAAGGAAGGGGG + Intergenic
947435976 2:230072561-230072583 CAAAGTTTTATGAAGGAGGAAGG + Intergenic
948549945 2:238764623-238764645 CAGAGCCAAGTGAAGGAGGGAGG + Intergenic
1169336913 20:4764167-4764189 CAGTGTCAAATGAAGGACTGAGG + Intergenic
1169769267 20:9183312-9183334 CAGAACTAACTGAGGGAGGGAGG - Intronic
1170345742 20:15384914-15384936 CAGAGCCAGATTAAGGAGGGGGG - Intronic
1170407362 20:16052435-16052457 AAGAGTTACAGGAGGGAGGGAGG + Exonic
1170494682 20:16913573-16913595 AAGAGTTTAATGAATGATGGGGG - Intergenic
1171116805 20:22531804-22531826 GAGAGGTGAATGAAGAAGGGAGG + Intergenic
1172221515 20:33277464-33277486 CAGGGGCAAAGGAAGGAGGGTGG - Intronic
1172643366 20:36455147-36455169 CAGAGTAAGAGGAGGGAGGGAGG - Intronic
1173464964 20:43273553-43273575 CATGGTTACCTGAAGGAGGGTGG - Intergenic
1174079288 20:47959627-47959649 AAAAGTAAAATGAAGGAGAGGGG - Intergenic
1174706353 20:52660274-52660296 AAGAACAAAATGAAGGAGGGTGG + Intergenic
1174827036 20:53777733-53777755 CACAGTTAAATGATGAAGTGAGG - Intergenic
1177112136 21:17041431-17041453 CAGGGTAAAGTGTAGGAGGGGGG - Intergenic
1177596487 21:23250056-23250078 CAGAGTTTAATAAAGGTGGGTGG - Intergenic
1178038594 21:28613337-28613359 CACAGTTACATTATGGAGGGAGG - Intergenic
1178365905 21:31988629-31988651 GAGAGAAAAATGAGGGAGGGAGG - Intronic
1178840845 21:36136387-36136409 GGGAGTGAAATGAAGGATGGGGG + Intronic
1181377839 22:22474670-22474692 AAAAGTTAAATGAATGAGAGGGG + Intergenic
1181624809 22:24116052-24116074 GAGAATTAAAGGAAGGAGGCTGG - Intronic
1182341844 22:29628953-29628975 CAGATTTAAATGAAGGATGTGGG + Intronic
1182677311 22:32049773-32049795 AAGACTTAGATGAAGGAGGCAGG - Intronic
1184331132 22:43828620-43828642 GAGAGTTAAATGAAGTGGGCGGG - Intronic
950174699 3:10864779-10864801 CAGACTCAAATGAAGGACAGAGG - Intronic
950341087 3:12245335-12245357 CAGAGTTTATTGATGGTGGGAGG + Intergenic
950672816 3:14537367-14537389 CAGAGGAACATGAAGCAGGGAGG - Intronic
951050132 3:18084753-18084775 CAGGGTAAAATGTTGGAGGGAGG + Intronic
952887530 3:38020760-38020782 CAGAGTGAACTGAAGGAAGCTGG + Intronic
953847636 3:46440707-46440729 CAGTGATTACTGAAGGAGGGAGG + Intronic
955609946 3:60746324-60746346 GAGAGATAATTGAAGGAGGTGGG + Intronic
957700665 3:83707001-83707023 TATAGTTAAATGAAGGATGCTGG + Intergenic
957824956 3:85429699-85429721 CATAGTAAAATGGAGGAGGTTGG + Intronic
959791938 3:110372450-110372472 CTGAGTTAAAATAAGGAGGCTGG - Intergenic
960042287 3:113162887-113162909 GATAATTAAATGATGGAGGGAGG + Intergenic
962191233 3:133312869-133312891 GACAATAAAATGAAGGAGGGAGG - Intronic
962377790 3:134873160-134873182 GAGAGAAAAAGGAAGGAGGGAGG + Intronic
962739988 3:138356627-138356649 CAGAGATGATAGAAGGAGGGTGG + Intronic
963006071 3:140727268-140727290 CAGAGGAAAATAAAGCAGGGTGG + Intergenic
963574723 3:147045713-147045735 AAGAGGTAAGTGAAGGAGGTTGG - Intergenic
964348533 3:155779720-155779742 AAGAGTTAAAAGAAGTAGGATGG + Intronic
964530977 3:157667481-157667503 CAGAATTAAAAGATGGAGGAAGG + Intronic
966211769 3:177460904-177460926 CAGAGTTAAATGAAGTTAGCTGG + Intergenic
966219497 3:177536220-177536242 GAGAGTCAAGTGAAGGTGGGAGG + Intergenic
967376206 3:188804452-188804474 CAGAATGAAATAAAGGTGGGAGG + Intronic
968686739 4:1964727-1964749 AAGAGAAAAATGAAAGAGGGGGG - Intronic
969234765 4:5858109-5858131 GCGAGTTTAAGGAAGGAGGGAGG - Intronic
970559410 4:17268199-17268221 CAGAGTTTGATGGAGGAGGCAGG - Intergenic
970963156 4:21897044-21897066 AAGAGTTAAATGCAAGAGAGAGG - Intronic
971745759 4:30578061-30578083 AAGAGTGAAATGAGGGAGGAAGG - Intergenic
972074926 4:35075724-35075746 CAGACTTAAATGAAGAAAGAAGG - Intergenic
974170069 4:58254969-58254991 GGGAGATAAATGAAGGAGGTTGG + Intergenic
974820395 4:67060363-67060385 GAGAGTTTAAATAAGGAGGGAGG + Intergenic
975058821 4:69970997-69971019 CAGAGGTAAAATTAGGAGGGGGG + Intergenic
976373529 4:84317961-84317983 CTGAATTAAATAAAGGGGGGAGG + Intergenic
976456025 4:85247568-85247590 CAGAGCAAAATGAGGGAGGCAGG - Intergenic
976679150 4:87735524-87735546 AGGAGTTAGATGAAGGAGAGTGG - Intergenic
976897000 4:90125396-90125418 CATTGTAAAAAGAAGGAGGGAGG + Intergenic
977422772 4:96824125-96824147 TAGAGAGAAAGGAAGGAGGGAGG - Intergenic
977507040 4:97915667-97915689 CAGAGCAAAATGACGGAGGCAGG + Intronic
977705383 4:100064887-100064909 CAGAGAGAAGGGAAGGAGGGAGG - Intergenic
978393070 4:108247912-108247934 CAGAGTCAAAGGAAGGGGGCAGG + Intergenic
978640635 4:110867178-110867200 CAGAGTTAAAGTAAGGCAGGGGG + Intergenic
978670302 4:111240643-111240665 CTGAGTTAAATAAAGAAGGAAGG + Intergenic
981298706 4:143162890-143162912 AAAATCTAAATGAAGGAGGGAGG - Intergenic
982013163 4:151126417-151126439 CAGTGCTAGAAGAAGGAGGGTGG - Intronic
982240732 4:153296853-153296875 CATTGTTAAATGGAAGAGGGAGG - Intronic
982346028 4:154360596-154360618 CAACGTTAAATGTAGGAAGGTGG + Intronic
983531022 4:168809940-168809962 AAGTGTTAATAGAAGGAGGGTGG + Intronic
984286977 4:177742833-177742855 CAATGTTAAATGAAGAAGGCAGG + Intronic
987766945 5:22244600-22244622 GAGAGAGAAAGGAAGGAGGGAGG + Intronic
988856738 5:35234405-35234427 CAGGATTAGATGAAGGAAGGAGG - Intergenic
989636297 5:43538805-43538827 AAGAGTGAAATGAAAGAGAGAGG - Intronic
990435215 5:55783610-55783632 CAGACCAAAAGGAAGGAGGGAGG + Intronic
991914135 5:71589090-71589112 TAGAGTTGTATGTAGGAGGGGGG + Intronic
993579796 5:89646155-89646177 CAAAATAAAGTGAAGGAGGGGGG - Intergenic
995059597 5:107798902-107798924 CAGTTTTAAATAAAGGAAGGGGG + Intergenic
996443606 5:123518746-123518768 CTGAGTTAGATGGAAGAGGGAGG + Intronic
996635654 5:125686130-125686152 CAGAGTTAAATGAAGAGATGGGG - Intergenic
998153860 5:139772966-139772988 CACAGTTTAATGAATGAGGCAGG + Intergenic
999652175 5:153778144-153778166 GAGAGACAAAGGAAGGAGGGAGG + Intronic
1000759599 5:165206034-165206056 GTTTGTTAAATGAAGGAGGGAGG + Intergenic
1001123305 5:168997434-168997456 TAGAATTAACTGAAAGAGGGAGG + Intronic
1001680135 5:173550650-173550672 GAGACTTAAATGAAAGTGGGTGG - Intergenic
1002825642 6:771079-771101 CAGAGAGAAAGGAAGGAAGGAGG - Intergenic
1003584683 6:7376686-7376708 CAGAGTTGGAGGAAGGAGGAGGG - Intronic
1004893937 6:20128226-20128248 CTGAGTTAAATACAGGAGGAGGG - Intronic
1005444131 6:25903606-25903628 CAAAGTATAATGAAGGAGAGAGG + Intergenic
1005955460 6:30660302-30660324 CAGAGTTAACTGGATGAGAGGGG + Intronic
1006373784 6:33660515-33660537 CAGATTTAAGGGAGGGAGGGAGG - Intronic
1009794390 6:68449183-68449205 AAGAGTTAAATGGGGGAGGACGG - Intergenic
1010189938 6:73184976-73184998 CAGAGTTTAATGAACATGGGAGG - Intronic
1010906327 6:81494590-81494612 TAGAGTTACATGCAGGAGGATGG + Intronic
1011362903 6:86547677-86547699 AAGAGTTTAATGCAAGAGGGAGG + Intergenic
1011931601 6:92721520-92721542 CAAAGAGAAATGAAGGAAGGGGG - Intergenic
1012056232 6:94414317-94414339 CAGACCTAAATGAAGGTGTGTGG + Intergenic
1013055041 6:106575118-106575140 CAGAGTTAAAATACAGAGGGGGG + Intronic
1013377188 6:109529010-109529032 GAGAGATAAAAAAAGGAGGGAGG - Exonic
1013535364 6:111058710-111058732 CAGAGTCAAACAAAGGAGGAAGG + Intergenic
1013749072 6:113381084-113381106 AAGAGGTAAATAAAGGAGGGAGG + Intergenic
1014175161 6:118324294-118324316 TAGAGTTACATTCAGGAGGGAGG - Intergenic
1016461285 6:144282661-144282683 AAGAGAGAAATAAAGGAGGGAGG - Intergenic
1016707956 6:147135495-147135517 CAGGTTTAAAGGAAGGAGAGTGG - Intergenic
1017947555 6:159108004-159108026 CAGAGTTTAATGGAGGAGCCCGG + Intergenic
1019907084 7:4072954-4072976 CAGAGTTTACTGAAGGAGAGTGG - Intronic
1022370865 7:29770114-29770136 GAGAGGGAAAAGAAGGAGGGAGG - Intergenic
1023356422 7:39371540-39371562 CAGGGGTAAAGGATGGAGGGAGG - Intronic
1023583942 7:41709446-41709468 AAGAGTATAATGAATGAGGGAGG + Intergenic
1023694636 7:42832129-42832151 CAGAGTGAATTGTAGGATGGAGG - Intergenic
1023718907 7:43072987-43073009 CAGAGGTACATGAGGGAGAGAGG + Intergenic
1023880510 7:44317840-44317862 AAGGGTTATATGAAGGAGTGTGG + Intronic
1024178141 7:46861785-46861807 GAGAGTTAAGAGGAGGAGGGTGG + Intergenic
1024266441 7:47610456-47610478 CAGAGTTAGATGAACAAGGAAGG - Intergenic
1024910845 7:54444862-54444884 CAGGGTTAAATGGATTAGGGCGG + Intergenic
1025190289 7:56891103-56891125 GAGAGAGAAATGAGGGAGGGAGG - Intergenic
1025681650 7:63685817-63685839 GAGAGAGAAATGAGGGAGGGAGG + Intergenic
1025888711 7:65624408-65624430 GAGAGTACAATGAGGGAGGGAGG - Intergenic
1026373066 7:69721295-69721317 CTGAATCAAGTGAAGGAGGGAGG - Intronic
1026571924 7:71538839-71538861 GAGAGAGAAAGGAAGGAGGGAGG + Intronic
1029286137 7:99467413-99467435 CAGAATGAACTGAACGAGGGTGG - Intergenic
1029515041 7:101018648-101018670 CAGAGCTAGATGAGGGTGGGAGG - Exonic
1031737771 7:125388352-125388374 CAGAGGTGAAAGATGGAGGGAGG + Intergenic
1031853740 7:126897556-126897578 GAGAGTACAATGAGGGAGGGAGG + Intronic
1032189031 7:129752265-129752287 CAGTGTAAAAGGAAGGAGTGGGG + Intronic
1032449556 7:132018121-132018143 CAGAAGTAAAGGAGGGAGGGAGG - Intergenic
1032449776 7:132020024-132020046 CAGAAATAAAGGAGGGAGGGAGG - Intergenic
1033905483 7:146196542-146196564 CAGAGGGAAAGGAGGGAGGGAGG + Intronic
1034059347 7:148072142-148072164 CAGGGGTAAAGGTAGGAGGGAGG - Intronic
1034438994 7:151077083-151077105 CAGAGGTAAAGGAGGCAGGGTGG - Exonic
1035057715 7:156046994-156047016 CAGACAGAAATGAAGGAAGGGGG + Intergenic
1035909504 8:3550011-3550033 CAGAGTTAAATGTAAGAAGGTGG - Intronic
1036612187 8:10359974-10359996 CAGAGATAAAGGAAGGAGGTTGG - Intronic
1037204322 8:16295320-16295342 CACAGATAAATGAAGGTGGATGG - Intronic
1037414266 8:18632173-18632195 CAGAGACAAAGGATGGAGGGAGG - Intronic
1038020747 8:23550337-23550359 CAGAGAAACGTGAAGGAGGGCGG - Intronic
1038423200 8:27447019-27447041 GAGAGTCAAAGGCAGGAGGGTGG - Intronic
1039449672 8:37662008-37662030 CAGAATTAAATGGAGAAGAGTGG + Intergenic
1040901792 8:52425130-52425152 CAGAGTTTAATGAAGGTGGCGGG + Intronic
1041350340 8:56942039-56942061 CAGAGTAAAATGGAGTAGGTTGG + Intergenic
1041807218 8:61865263-61865285 TAGATTTTAATGATGGAGGGAGG - Intergenic
1042440698 8:68822405-68822427 AAGTGTTATATGAAGCAGGGTGG - Intergenic
1044979429 8:97700772-97700794 GTTAGTTAAATGGAGGAGGGTGG + Intronic
1045233095 8:100324846-100324868 AAGAGAGAAAGGAAGGAGGGAGG - Intronic
1045256214 8:100525022-100525044 TAGAGTTATATGGAGGAGTGGGG + Intronic
1045628175 8:104082230-104082252 GAGAATTAAAGGAAGGAGAGAGG + Intronic
1045637124 8:104204973-104204995 AAGTCTTAATTGAAGGAGGGAGG + Intronic
1046350621 8:113006341-113006363 CAGAGTTAAAAGAAGACTGGTGG + Intronic
1046401352 8:113708307-113708329 GACAGTTAAATGTATGAGGGAGG + Intergenic
1046426946 8:114066096-114066118 GAGAGATAAATGGAGGAGGTTGG + Intergenic
1047905548 8:129469134-129469156 GAGAGTTGAATGTATGAGGGAGG - Intergenic
1048412856 8:134193576-134193598 CAGCATCAAATGAATGAGGGAGG + Intergenic
1050038933 9:1466816-1466838 CTGAGTTGGAGGAAGGAGGGAGG + Intergenic
1050105299 9:2159214-2159236 CTGAGATAAATGAAGTTGGGGGG - Intronic
1051215022 9:14788299-14788321 GAGAGTTAAATGGAAGATGGAGG - Intronic
1052299734 9:26940551-26940573 AAGAGTTAAAAGATGGATGGTGG + Intronic
1056508189 9:87277335-87277357 CTGAATTAAATGAGGGAGGGCGG + Intergenic
1056705368 9:88948057-88948079 CAGAATTAAGTGAAGGAGGTAGG + Intergenic
1057292103 9:93813339-93813361 CAGAGTCCAGTGAGGGAGGGAGG - Intergenic
1057391015 9:94641435-94641457 CGGCGTTGAATGAAGGAAGGTGG + Intergenic
1058078559 9:100676171-100676193 CAGAGTTGGAAGAAGGAGGTGGG + Intergenic
1059171092 9:112125880-112125902 CAGAGTTATTTCCAGGAGGGAGG + Intronic
1061520181 9:131113143-131113165 CAGTGAGAAATGAGGGAGGGAGG + Intronic
1061846580 9:133391605-133391627 CAGGGTTAAATGGATTAGGGCGG + Intronic
1185766839 X:2732498-2732520 AAGAGAGAAAAGAAGGAGGGAGG - Intronic
1185820211 X:3195879-3195901 GAGAGTTAAAGGAAGGAAGGAGG + Intergenic
1186072100 X:5833152-5833174 GAGAGATAAATGAAAGAGAGAGG - Intergenic
1186074892 X:5867372-5867394 AAGAGTAGAATGAAAGAGGGAGG - Intronic
1186098589 X:6130256-6130278 CATTGTTATATGAAGGAGTGAGG - Intronic
1186962608 X:14752928-14752950 CAGAGAAGAAGGAAGGAGGGAGG - Intergenic
1187245767 X:17551692-17551714 GAGAATCAAATGAAGGAGGGTGG + Intronic
1188759366 X:34006964-34006986 GATAGTTGAATGAAGAAGGGAGG + Intergenic
1188926673 X:36051863-36051885 CAGAGGTAATTGAATCAGGGGGG + Intronic
1189024645 X:37380103-37380125 CATATTTAAATGAAGGAGAATGG + Intronic
1189382861 X:40514062-40514084 CAGGGTGGAGTGAAGGAGGGAGG + Intergenic
1189452024 X:41144407-41144429 CATAGTTAAATGAAGGAGATAGG + Intronic
1190000828 X:46685002-46685024 CAGAGACAAGTGATGGAGGGTGG - Intronic
1190202018 X:48369999-48370021 AAGAGGTAAACGAAGGAGAGGGG - Intergenic
1190208520 X:48425414-48425436 AAGAGGTAAACGAAGGAGAGGGG + Intergenic
1190255051 X:48756102-48756124 CAGAGTGAAATGAATGATGGAGG + Intergenic
1190559606 X:51673878-51673900 CAGACGTGAAGGAAGGAGGGAGG + Intergenic
1190564685 X:51719443-51719465 CAGACGTGAAGGAAGGAGGGAGG - Intergenic
1190713218 X:53083901-53083923 AGGAGTTAAATGAAGGAAAGGGG + Intronic
1192569573 X:72191827-72191849 TAGAGATAAATGAAGGAGCAAGG - Intronic
1193310179 X:79998586-79998608 AAGAGATAAATGTAGGAGGATGG + Intergenic
1193325849 X:80177943-80177965 CACAGTGCAATGAAGGAGGTGGG - Intergenic
1193945100 X:87724684-87724706 CAGGGGTAAGTGAAGGAGAGAGG + Intergenic
1194162258 X:90468275-90468297 CAGAGGTAAATGAATCATGGGGG + Intergenic
1194655000 X:96561971-96561993 CACAGTTAAATGAAGGGGAATGG - Intergenic
1200301788 X:154983840-154983862 CAGAGACAAATGAGGGAGGAAGG - Intronic
1200508534 Y:4046012-4046034 CAGAGGTAAATGAATCATGGGGG + Intergenic
1200807038 Y:7443584-7443606 GAGAGAGAAAGGAAGGAGGGAGG - Intergenic
1201317224 Y:12659539-12659561 AAGAGTTAACGGAAGGCGGGTGG + Intergenic
1202067214 Y:20952426-20952448 CAAAGTTGAAGTAAGGAGGGTGG - Intergenic