ID: 1065364058

View in Genome Browser
Species Human (GRCh38)
Location 10:24917741-24917763
Sequence TTGGGACTCCCCCACTGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 80}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065364058_1065364060 -7 Left 1065364058 10:24917741-24917763 CCTTTTCAGTGGGGGAGTCCCAA 0: 1
1: 0
2: 1
3: 4
4: 80
Right 1065364060 10:24917757-24917779 GTCCCAAATGCAATAGATGGAGG No data
1065364058_1065364059 -10 Left 1065364058 10:24917741-24917763 CCTTTTCAGTGGGGGAGTCCCAA 0: 1
1: 0
2: 1
3: 4
4: 80
Right 1065364059 10:24917754-24917776 GGAGTCCCAAATGCAATAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065364058 Original CRISPR TTGGGACTCCCCCACTGAAA AGG (reversed) Intronic
901442735 1:9288633-9288655 ATTGGTCTCTCCCACTGAAATGG + Intergenic
901542263 1:9926381-9926403 ATGCAACTCCACCACTGAAATGG - Intronic
902528633 1:17076100-17076122 GTGGGACTCCCGCACACAAAAGG - Intronic
903203301 1:21761307-21761329 TTGAGACTCCCATACTGAAGTGG + Intronic
904986210 1:34550559-34550581 TTGGGACTCCTGGACTGAACTGG - Intergenic
909197633 1:72648270-72648292 TTGTGCCTCCCCCACTGCAGTGG - Intergenic
911433891 1:97830242-97830264 TTGGGCCTCCACCACTGTAGAGG + Intronic
913028007 1:114865467-114865489 TTGGAACACCCACAATGAAAAGG - Intronic
915101940 1:153507152-153507174 TTGGGCCTCCCACACAGACATGG + Intergenic
917460922 1:175228331-175228353 ATTGGACTCCACCACGGAAAGGG - Intergenic
1063737734 10:8779942-8779964 TTGGAACTCCTTCTCTGAAAAGG + Intergenic
1064308666 10:14191262-14191284 TTGGGAATCCCAAACAGAAAGGG + Intronic
1065364058 10:24917741-24917763 TTGGGACTCCCCCACTGAAAAGG - Intronic
1072079739 10:92017219-92017241 TAGGGACTGCCTCACTGAGAAGG + Intronic
1074122321 10:110501803-110501825 TCGGTTCTTCCCCACTGAAATGG + Intronic
1083987383 11:66224543-66224565 TTAGGAGTCCACAACTGAAATGG - Intronic
1085841803 11:80020115-80020137 TTGGGACTCCACCTTTTAAAAGG - Intergenic
1099369871 12:81815991-81816013 TTGTGACAGACCCACTGAAAAGG + Intergenic
1100604516 12:96140605-96140627 ATGGGACTCACCTACTTAAAAGG - Intergenic
1101074529 12:101114836-101114858 GCAGGACTCCCCTACTGAAAGGG - Intronic
1110783723 13:79497885-79497907 TTGGAAGGCCCCCACAGAAAAGG - Intronic
1112707884 13:102092493-102092515 ATGGGTCTTCCACACTGAAAGGG + Intronic
1113238852 13:108314160-108314182 TTTGGACTCATCAACTGAAAAGG + Intergenic
1115641632 14:35339049-35339071 TTGGGACGGCCCCACAGATAGGG + Intergenic
1119138720 14:72245248-72245270 TAGGGTCTCCCCCACTGAGCTGG - Intronic
1131329546 15:91484431-91484453 GTGGGAATCCCCCAGTGAATAGG + Intergenic
1134098654 16:11436253-11436275 TTGCAACTCCTCCACAGAAAAGG + Intronic
1136504198 16:30692374-30692396 TTCCGATTCCCCCACTGCAATGG + Intergenic
1138243331 16:55446580-55446602 TTGGGATTCCTGAACTGAAAAGG + Intronic
1139279076 16:65754310-65754332 TTGGCACTCCCCCACTGATATGG - Intergenic
1141804843 16:86335778-86335800 TGGGTCCTCCCGCACTGAAATGG + Intergenic
1144201660 17:12947500-12947522 TGAGGACTCCCCCTGTGAAAAGG + Intronic
1148785078 17:50142276-50142298 TCAGGACTCCCACACGGAAATGG + Intronic
1150307598 17:64099789-64099811 GTGGGTCTCCACCACAGAAAAGG - Intronic
1150992988 17:70282419-70282441 TAGGGTCTCCCCCACTGAGCTGG + Intergenic
1152423960 17:80209005-80209027 CTGGGACACCCCCACCGAACAGG - Exonic
1153677364 18:7467640-7467662 TTGGGACTCCCCTCCAGAACTGG + Intergenic
1153912895 18:9719857-9719879 TTGGCACACTCCCACTGAAAGGG - Intronic
1157358125 18:46953872-46953894 TTTGGCATCCCCCAATGAAAAGG - Intronic
1159700531 18:71621110-71621132 TTCTGACTACCCCACTGACAGGG - Intergenic
928415246 2:31086315-31086337 TTGGGACTGCCCTACTGAGCAGG + Intronic
932308002 2:70717441-70717463 TGGAGACTCCCCCACTGAAGTGG - Intronic
933996088 2:87671074-87671096 TTGGGAAACCCCCAGTGAGATGG - Intergenic
934042383 2:88138501-88138523 TTGGGACTGCCTCACATAAATGG + Intergenic
934208197 2:89951481-89951503 CTGGGACTCCCACACCAAAATGG - Intergenic
936297767 2:111279838-111279860 TTGGGAAACCCCCAGTGAGATGG + Intergenic
941546959 2:166862806-166862828 TTGTTTCTCCCCCACAGAAATGG + Intergenic
941588002 2:167383587-167383609 TTCTGACTCCTCCACTGAGATGG + Intergenic
943981340 2:194555121-194555143 TTGTCACTGCCCCAGTGAAAAGG + Intergenic
946206994 2:218116976-218116998 TAGGGTCTCCCCGACTGAACTGG + Intergenic
948117329 2:235503253-235503275 TGGATTCTCCCCCACTGAAAAGG - Intronic
1171189882 20:23151347-23151369 TTGGGAGGCCCCCACAGCAAGGG - Intergenic
1173690186 20:44954762-44954784 TTTGGTATCCCCCACTGAACCGG + Intronic
1175486191 20:59348358-59348380 TTGAGACAACCCCACAGAAAAGG - Intergenic
1180157186 21:45983412-45983434 ACGGGGCTCCCCCACTGAGACGG + Intronic
953477675 3:43219514-43219536 TTGGGACTCCGTGATTGAAAAGG - Intergenic
954994355 3:54867885-54867907 GTGGGCCTCCCCCACTGATCAGG + Intronic
958739116 3:98046818-98046840 TTCGCACTCCCCCATTAAAAGGG - Intergenic
966460649 3:180172659-180172681 TTGGGAATCTGCCACTGAGAGGG - Intergenic
973268286 4:48233099-48233121 CTGGGAATACCACACTGAAAAGG + Intronic
976279068 4:83308724-83308746 TTGGGGCTCAGCCACTGAAATGG + Intronic
984376999 4:178944756-178944778 TTAGGACTTCAACACTGAAAGGG + Intergenic
986442391 5:7793598-7793620 TTGGCACTGCCTCACTGCAAGGG + Intronic
996362726 5:122668526-122668548 CTGGCCCTCCCCCAGTGAAATGG - Intergenic
996651485 5:125882329-125882351 ATGCAACTCCCCCACTCAAAAGG + Intergenic
1004641116 6:17516245-17516267 TTGGGACTCTCCCACTAGATTGG + Intronic
1014276811 6:119397858-119397880 TTGGGACTCACCGAGTGAATTGG + Intergenic
1016550068 6:145269679-145269701 GTGGGTTCCCCCCACTGAAAGGG - Intergenic
1020844224 7:13262174-13262196 TTGGGACTCTTCTCCTGAAAAGG - Intergenic
1021707386 7:23381107-23381129 TTGGGACTCCCACACAGCAATGG + Intronic
1023870594 7:44261219-44261241 TTGGGCAGCCCCCACTGGAAAGG - Intronic
1023968242 7:44974552-44974574 TCCGAACTCCCCCACTGAACTGG - Intronic
1024680348 7:51680531-51680553 TTGGGTCTCCCTCTCTGAACTGG + Intergenic
1025122529 7:56317415-56317437 TAGGGTCTCCCCGACTGAGATGG + Intergenic
1036629340 8:10499544-10499566 TTGGGACAGCTGCACTGAAAAGG + Intergenic
1039468819 8:37801373-37801395 GTGGGCCTCCCCCAGGGAAAAGG + Intronic
1040528388 8:48244523-48244545 TTGGGTCTCCCCGACTGAGCTGG - Intergenic
1048926649 8:139277857-139277879 GTGGGAAGCCCCCACTGCAAAGG + Intergenic
1050113872 9:2242866-2242888 TTGGGAACCCCCCACTGTTATGG + Intergenic
1055757916 9:79573869-79573891 TTGTGACGCCCCCACAAAAAAGG - Intronic
1057787645 9:98099130-98099152 TTGAGACACCCCACCTGAAAAGG - Intronic
1060243426 9:121924640-121924662 TTGGGAGTGCCCTAATGAAAAGG + Intronic
1190950066 X:55134699-55134721 TTGCCACACCCCCACTGCAATGG - Intronic
1190999950 X:55649033-55649055 TTGTGAATACCCAACTGAAAAGG - Intergenic
1198671332 X:139083969-139083991 TCGGCACCCCCCGACTGAAAAGG - Intronic
1200412214 Y:2872168-2872190 TAGGGTCTCCCCGACTGAACTGG - Intronic