ID: 1065374756

View in Genome Browser
Species Human (GRCh38)
Location 10:25027459-25027481
Sequence AACCGCAACCTGCATCTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58774
Summary {0: 1, 1: 1, 2: 180, 3: 5775, 4: 52817}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065374756_1065374757 10 Left 1065374756 10:25027459-25027481 CCTGGGAGATGCAGGTTGCGGTT 0: 1
1: 1
2: 180
3: 5775
4: 52817
Right 1065374757 10:25027492-25027514 TGCGCCGTTGCACTCCAGCCTGG 0: 102
1: 5780
2: 46384
3: 153060
4: 222491
1065374756_1065374758 11 Left 1065374756 10:25027459-25027481 CCTGGGAGATGCAGGTTGCGGTT 0: 1
1: 1
2: 180
3: 5775
4: 52817
Right 1065374758 10:25027493-25027515 GCGCCGTTGCACTCCAGCCTGGG 0: 263
1: 14063
2: 99752
3: 221077
4: 218082

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065374756 Original CRISPR AACCGCAACCTGCATCTCCC AGG (reversed) Intronic
Too many off-targets to display for this crispr