ID: 1065374757

View in Genome Browser
Species Human (GRCh38)
Location 10:25027492-25027514
Sequence TGCGCCGTTGCACTCCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 427817
Summary {0: 102, 1: 5780, 2: 46384, 3: 153060, 4: 222491}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065374756_1065374757 10 Left 1065374756 10:25027459-25027481 CCTGGGAGATGCAGGTTGCGGTT 0: 1
1: 1
2: 180
3: 5775
4: 52817
Right 1065374757 10:25027492-25027514 TGCGCCGTTGCACTCCAGCCTGG 0: 102
1: 5780
2: 46384
3: 153060
4: 222491

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065374757 Original CRISPR TGCGCCGTTGCACTCCAGCC TGG Intronic
Too many off-targets to display for this crispr