ID: 1065374758

View in Genome Browser
Species Human (GRCh38)
Location 10:25027493-25027515
Sequence GCGCCGTTGCACTCCAGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 553237
Summary {0: 263, 1: 14063, 2: 99752, 3: 221077, 4: 218082}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065374756_1065374758 11 Left 1065374756 10:25027459-25027481 CCTGGGAGATGCAGGTTGCGGTT 0: 1
1: 1
2: 180
3: 5775
4: 52817
Right 1065374758 10:25027493-25027515 GCGCCGTTGCACTCCAGCCTGGG 0: 263
1: 14063
2: 99752
3: 221077
4: 218082

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065374758 Original CRISPR GCGCCGTTGCACTCCAGCCT GGG Intronic
Too many off-targets to display for this crispr