ID: 1065375352

View in Genome Browser
Species Human (GRCh38)
Location 10:25034817-25034839
Sequence ACAGCATTTAAGGGAAAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 5, 3: 21, 4: 307}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065375352 Original CRISPR ACAGCATTTAAGGGAAAAGG GGG (reversed) Intronic
901256210 1:7829406-7829428 GCTGCATTTAAGTGAAAAGGTGG - Intronic
901468082 1:9436054-9436076 GCAGCATTGAAAGGAAACGGGGG + Intergenic
901938037 1:12641004-12641026 ACAGCATTTCAGGGAAAAGTGGG - Intergenic
902073289 1:13761041-13761063 ACAGCTTTTAAGAGAGAAGCAGG - Intronic
903697730 1:25220725-25220747 ACAGCAAGTAAGGGTAAAAGAGG + Intergenic
903794078 1:25915213-25915235 AAAGAATCTCAGGGAAAAGGAGG - Intergenic
905249518 1:36638932-36638954 AGACCATTTAAAGGAAAAGGAGG - Intergenic
905271393 1:36790018-36790040 ACAGGATATAAGGGAAAAGATGG - Intergenic
905532123 1:38688177-38688199 GCAGGACTTGAGGGAAAAGGAGG - Intergenic
906118478 1:43371218-43371240 TCAACATTTAATGGACAAGGTGG + Intergenic
906140759 1:43532186-43532208 GCAGCATTCCAGGGAAATGGGGG - Intronic
906919847 1:50052035-50052057 AAAGTAATTAAGGTAAAAGGAGG - Intronic
908312805 1:62902417-62902439 ACAAAATTCAAGGAAAAAGGAGG + Intergenic
908973634 1:69868998-69869020 GCAGCATTTAAGTTAAAATGAGG - Intronic
909512120 1:76465083-76465105 ATGGAATTTGAGGGAAAAGGAGG + Intronic
909573174 1:77140552-77140574 ACAACATCTAAGGTAAAAGTGGG + Intronic
910488581 1:87743215-87743237 ACTGAATTTATGGTAAAAGGAGG + Intergenic
911250309 1:95569221-95569243 AGAGCATTTATGGGAGAATGGGG - Intergenic
912037424 1:105335979-105336001 ACAGTATCTAAGAGCAAAGGAGG + Intergenic
912365421 1:109129576-109129598 ACAGCCTTTAAGGGAACAAGTGG + Intronic
913377410 1:118168281-118168303 ATAGGTTTTAAGGGAAAAGTTGG + Intronic
913536752 1:119780327-119780349 ACAGCAATGAAGGGAAGAGAAGG + Intergenic
914843285 1:151265744-151265766 ACAGCATTATAGGGAAGAGGCGG - Intronic
915911098 1:159916075-159916097 AAAGCAATTAAGGGAGAAGCAGG - Intergenic
917660691 1:177174182-177174204 ACAGCACTTAAGGGACACTGTGG + Intronic
919132343 1:193467088-193467110 AAAGTATTTTATGGAAAAGGTGG + Intergenic
920448101 1:206035421-206035443 AAACCATTCAAGGGAAGAGGGGG - Intergenic
920739328 1:208565246-208565268 AGAGCATTTCAGGGAAAGGGAGG + Intergenic
920853899 1:209648222-209648244 AAAGAATGTTAGGGAAAAGGAGG + Intronic
921272366 1:213483995-213484017 ACAGCATTTTAAGAATAAGGAGG - Intergenic
922689953 1:227680377-227680399 AAAGGATTTAAGGGAAACTGTGG + Intergenic
922908678 1:229197328-229197350 ACAGGAAGTAAGGGAAAAGATGG - Intergenic
924200246 1:241651041-241651063 AAAGCTTTAAAGGAAAAAGGAGG + Intronic
924658848 1:245997760-245997782 ACAGCACTTTAGGACAAAGGGGG + Intronic
924677725 1:246197297-246197319 ACAGTGTGGAAGGGAAAAGGAGG + Intronic
1063943574 10:11155991-11156013 TCAGCATTTAACAGAAAAGTAGG + Intronic
1064242371 10:13642235-13642257 ACCACATTTATGGGGAAAGGAGG - Intronic
1064318392 10:14278944-14278966 AAAGCACTAAAGGGAAAGGGAGG - Intronic
1065375352 10:25034817-25034839 ACAGCATTTAAGGGAAAAGGGGG - Intronic
1065447633 10:25819684-25819706 ACAGGTTTTTAGGGAACAGGTGG + Intergenic
1065680053 10:28220941-28220963 AAAGCATTTAAGTGAAAGGAAGG + Intronic
1065977469 10:30855160-30855182 AGGGCATTCAAAGGAAAAGGAGG + Intronic
1066243052 10:33556480-33556502 GCAGCATTCACTGGAAAAGGGGG - Intergenic
1066761226 10:38755321-38755343 ACAGAATTTAAGGCAAGAGTGGG - Intergenic
1067140259 10:43650332-43650354 AAAGCATTGGTGGGAAAAGGTGG + Intergenic
1071703435 10:87968373-87968395 ACAGTATTTAAAGGTAAACGAGG - Exonic
1072494514 10:95943018-95943040 ACAGGAATTAAGGAAAAAGGAGG - Intergenic
1073011212 10:100361164-100361186 ATAGCAATAAAGTGAAAAGGAGG - Exonic
1073864712 10:107788214-107788236 ACAGAAATGAAGGGAAAATGTGG + Intergenic
1075300641 10:121320798-121320820 AAATCATTTAAGGGCAAAGAAGG - Intergenic
1075578428 10:123597773-123597795 ACATCATTGAAGGGAAGAGGGGG + Intergenic
1075708810 10:124519373-124519395 ACAGTGTTCAAGGAAAAAGGAGG - Intronic
1076587585 10:131559939-131559961 ACAGCAGTTGAGGGGAAATGGGG - Intergenic
1078526133 11:12102966-12102988 AAAGCTTTTAAGAGAAAAGTAGG + Intronic
1078758645 11:14234291-14234313 AGAGCAAAGAAGGGAAAAGGGGG - Intronic
1078884100 11:15482652-15482674 ACAGAATTAAAGGGAAAAGAAGG - Intergenic
1079142321 11:17820143-17820165 ATAGCACTTAAAGGAAAAGTAGG - Intronic
1079377899 11:19910296-19910318 ACAGCATTTAACATAAAAGAGGG - Intronic
1079396348 11:20067079-20067101 CCAGCATGTAAGGGACAAAGAGG + Intronic
1079413982 11:20215769-20215791 AAACCATATAAGAGAAAAGGTGG + Intergenic
1080145758 11:28981530-28981552 ATAGAATTTAAGGGACAAGGAGG - Intergenic
1080947932 11:36995925-36995947 AAAGCATTTGAGGAAGAAGGGGG - Intergenic
1082138830 11:48582413-48582435 AAAGTACTTAAGGGAATAGGTGG - Intergenic
1084268425 11:68016707-68016729 ACAGCCTTCAAGGCAAAGGGAGG - Intronic
1084367569 11:68712627-68712649 ACAGCACTGAAGGGGAAAGTGGG + Intronic
1085002558 11:73053985-73054007 ACAAATTTTAAGGGAAAAGGGGG + Intronic
1087405015 11:97719369-97719391 ACAGAATTAAAGGGAAAATTAGG + Intergenic
1087701644 11:101442147-101442169 ACAGCCTGGAAGAGAAAAGGTGG - Intergenic
1087755421 11:102049520-102049542 ACACCATCTTAGGGAAAGGGAGG - Intronic
1088275007 11:108075818-108075840 ACATGATTTAAAGGGAAAGGGGG - Intronic
1088738779 11:112749883-112749905 ACAGCAGTTAAGGAAAAAGGGGG + Intergenic
1089442205 11:118527183-118527205 AAAGCATTTCAGGGAGAAGCTGG + Intergenic
1090021146 11:123130129-123130151 AAAATATTCAAGGGAAAAGGAGG + Intronic
1091866762 12:3845139-3845161 ACAACACCAAAGGGAAAAGGGGG - Intronic
1092001992 12:5040315-5040337 ACAGCATTTAAAGGGACAGAGGG - Intergenic
1094027585 12:25975211-25975233 ACAGGATATAAGGGAGAATGTGG + Intronic
1094871919 12:34603554-34603576 AAAGCATATCAGGCAAAAGGGGG + Intergenic
1097643787 12:62212127-62212149 ACAGCAAATCAGGGAAAAGCAGG + Intronic
1098272355 12:68781020-68781042 ACAGCAGTAAGGGGAAAAGTGGG + Exonic
1101330866 12:103756905-103756927 ACAGCATTTCAAAGAAAAGACGG + Intronic
1103130125 12:118460840-118460862 ACAACATTCAAGGTAAAAGTTGG + Intergenic
1104803073 12:131568060-131568082 ACAGAAATTAAGGGAAAGAGGGG - Intergenic
1107461598 13:40608817-40608839 ACTGCTTTGAAGGAAAAAGGAGG - Intronic
1107971908 13:45651260-45651282 AAAGCAGTCAAGGGAAAAGGAGG - Intergenic
1108162075 13:47651258-47651280 TCAGAATTTAAGGGAAAAATAGG - Intergenic
1108586833 13:51877183-51877205 ACAGCATTTAAATGATAAGTTGG - Intergenic
1109224733 13:59679366-59679388 ACAGCAGTAAAGGGAAAGAGGGG - Intronic
1110755658 13:79171206-79171228 TTAGCACTGAAGGGAAAAGGAGG + Intergenic
1110764605 13:79268342-79268364 AGAGGATTGAAGGGAAGAGGAGG + Intergenic
1111226961 13:85287442-85287464 ACAGCATTTAAAAGAAAATAAGG - Intergenic
1112079493 13:95953518-95953540 AGATCATATAATGGAAAAGGAGG + Intronic
1112171561 13:96977628-96977650 ACAGCATTAATGGGAAAGGCAGG + Intergenic
1112195999 13:97227013-97227035 TCTGCTTTTAAGGAAAAAGGGGG - Intronic
1112311135 13:98318410-98318432 ACAGCAATTAAGGTTAAATGAGG - Intronic
1112382700 13:98907580-98907602 ACATCATTTATTGGAAAAGAAGG + Intronic
1112523960 13:100125432-100125454 ACTGCATTTAATGGGAAGGGAGG + Intronic
1112749646 13:102568961-102568983 ACAAAATTTAAGCCAAAAGGAGG - Intergenic
1116048838 14:39779228-39779250 ACAGCAGTTAAGAGACAAAGAGG - Intergenic
1116732740 14:48645100-48645122 AAGGCATATAAGAGAAAAGGTGG - Intergenic
1117934938 14:60893341-60893363 AAAGGATCTAATGGAAAAGGTGG - Intronic
1119210471 14:72827779-72827801 ACTGTATTTAAGAGTAAAGGGGG - Intronic
1119790195 14:77343077-77343099 ACTGCATTCAAAGGAAGAGGAGG + Intronic
1120040619 14:79748846-79748868 ACAGCATTTATGGGGAAAACAGG - Intronic
1120744385 14:88140666-88140688 AGACCATTTAAGAGGAAAGGAGG + Intergenic
1120870019 14:89328685-89328707 ACAGCCTCAAAGGGAAACGGAGG + Intronic
1121621259 14:95350052-95350074 ACAGAATTAAAGGGAGAAAGAGG - Intergenic
1122079949 14:99259924-99259946 AGATCATTAAAGGGAAAAAGAGG - Intronic
1124101410 15:26697598-26697620 GCAGCATTTAAGGGTGAATGTGG - Intronic
1126302545 15:47214390-47214412 TAAACATTTAATGGAAAAGGAGG + Intronic
1126567655 15:50116379-50116401 ACAGCAGTGAAGGGAAAAGGAGG + Intronic
1128304915 15:66592013-66592035 AAAGCAATTAAGGGATGAGGTGG + Intronic
1128415224 15:67438790-67438812 ACAGCAGTTAAGAGACAAAGAGG + Intronic
1129445252 15:75612515-75612537 ACAGCATCTAAGAGAAAAGGGGG - Intronic
1129570368 15:76676311-76676333 ACAGCATTTGAAATAAAAGGAGG - Intronic
1130052801 15:80497869-80497891 CAAGAATTTAAGGGAGAAGGGGG + Intronic
1130293743 15:82627610-82627632 CCAGGATTTAAGGCAAAAAGGGG + Intronic
1130890765 15:88132051-88132073 ACAACCTTTAAGGTAAAAGCAGG + Intronic
1131161012 15:90104795-90104817 ACAGGATTTACGGGAAAGGCTGG - Intergenic
1131408910 15:92189559-92189581 ACAGCATTACAATGAAAAGGAGG + Intergenic
1134693037 16:16203578-16203600 ATAGCATTTAAAAGGAAAGGCGG - Exonic
1134978810 16:18591117-18591139 ATAGCATTTAAAAGGAAAGGCGG + Intergenic
1139125074 16:64068130-64068152 ACAGCTTTTATGGGAAATGCAGG - Intergenic
1139681206 16:68565242-68565264 ACAGCCTATAAGGGTAAAGCTGG + Exonic
1140596292 16:76418939-76418961 AGAGAATTTAAGTCAAAAGGAGG - Intronic
1141053076 16:80790394-80790416 ACAGCAATTAAGAGAAAAAAAGG + Intronic
1142883966 17:2901369-2901391 AAAGCAGAGAAGGGAAAAGGAGG - Intronic
1143935697 17:10481937-10481959 ACAGCATGGAAAGGAAATGGGGG - Intergenic
1144889194 17:18484291-18484313 AGAGCAGTTATGGGAAACGGAGG - Intronic
1145143014 17:20460005-20460027 AAAGCAGTTATGGGAAACGGAGG + Intronic
1145792860 17:27638680-27638702 AGAGCAGTTACGGGAAATGGAGG - Intronic
1146427519 17:32756197-32756219 ACAGTATTTAAAGGTAAACGAGG - Intronic
1148114184 17:45165302-45165324 AGAGAATTTCAGGGAAAAGGAGG - Intronic
1148259974 17:46173174-46173196 CCAGCATTTAAGGGTCCAGGAGG - Intronic
1149105215 17:52955343-52955365 ATAGGTTTTAAGGGAACAGGTGG + Intergenic
1149287631 17:55183108-55183130 ATAGCATATAAGTCAAAAGGAGG + Intergenic
1149354133 17:55822264-55822286 TCAGTAATTAAGGGGAAAGGGGG + Intronic
1149530075 17:57388242-57388264 ACTTCCTTTGAGGGAAAAGGGGG - Intronic
1152267835 17:79306610-79306632 GCAGCATGGAAGGGAAAGGGAGG - Intronic
1152995248 18:400354-400376 ACAAAACTTAAGGGAAAAGAGGG + Intronic
1153795767 18:8620634-8620656 ACAGCATTTGATGGAGAAGAGGG + Intronic
1157221840 18:45833793-45833815 ACCGAATATGAGGGAAAAGGTGG + Intronic
1157743850 18:50117588-50117610 AGAGCATTTAAGGAACAAGTAGG - Intronic
1158299908 18:56040121-56040143 ATATCATTTGAGGGAAAAGAGGG + Intergenic
1159600944 18:70428141-70428163 ACAGCCTTTAAATGAAAAGCAGG - Intergenic
1162008298 19:7794207-7794229 ACACCATTTAGAGGGAAAGGTGG - Intergenic
1162836440 19:13321702-13321724 ACAGTATAAAAGAGAAAAGGTGG + Intronic
1164875018 19:31678594-31678616 ACAGAATCTAAGGGAACAGATGG + Intergenic
1167060659 19:47143682-47143704 ACAGCCCTTAAGGCACAAGGAGG - Intronic
1168580104 19:57548166-57548188 ACACCATTAAAGGGAAAATCTGG + Intronic
925448086 2:3945003-3945025 TCAGCATGTGAGGGCAAAGGAGG - Intergenic
926267831 2:11343149-11343171 GATGCATTTATGGGAAAAGGGGG - Intronic
926891020 2:17638893-17638915 AGAGCATTTGAGGGATAACGGGG - Intronic
927311173 2:21633332-21633354 ACAGCAATTCAGAGAAAAGCTGG + Intergenic
927633889 2:24797530-24797552 TCAGCATTTAATGGTCAAGGAGG + Intronic
929745427 2:44652692-44652714 ATATCCTTTAAGAGAAAAGGCGG + Intronic
929766042 2:44844717-44844739 ACAGCATTTGAGGTGAAGGGAGG + Intergenic
930695486 2:54407370-54407392 ACAGCATGAAAGAGAACAGGAGG + Intergenic
930706011 2:54505773-54505795 ACAGCAATTCAAGGAAAACGTGG - Intronic
931428228 2:62190220-62190242 ACAGCATTTATGGGACGTGGAGG - Intergenic
931511932 2:63007542-63007564 ACTGCATTTAAAGGGAAAGTAGG - Intronic
933843697 2:86308250-86308272 ACAGCATTACAGAAAAAAGGGGG + Intronic
935935507 2:108178037-108178059 GCAGCATTTGAGGGAGAAAGGGG + Intergenic
937153336 2:119701119-119701141 AAAGGAATAAAGGGAAAAGGAGG - Intergenic
937203575 2:120222177-120222199 ACAACATTTAGGCGAAAGGGGGG - Exonic
938160945 2:128983879-128983901 ACAGAATTTAAGAGATGAGGTGG + Intergenic
938267216 2:129936740-129936762 AGAGTATATAAAGGAAAAGGAGG - Intergenic
939420826 2:141966334-141966356 AAAGCCTGTAATGGAAAAGGGGG + Intronic
939672165 2:145025851-145025873 ATAGGATTTTAGGGAGAAGGTGG + Intergenic
940224658 2:151389030-151389052 ATAAAATTTTAGGGAAAAGGTGG - Intergenic
940514073 2:154657710-154657732 TAAGCATTTATGTGAAAAGGAGG - Intergenic
941027537 2:160475264-160475286 ACAGGATAGAGGGGAAAAGGTGG - Intronic
941578471 2:167265788-167265810 ACAGGATTTGGGGGAAGAGGAGG + Intergenic
942043727 2:172087189-172087211 ACACAATTTAAAGGCAAAGGAGG - Intronic
943451689 2:188050246-188050268 AAAGTAATTAAGGTAAAAGGAGG + Intergenic
944543287 2:200774936-200774958 ACAGGTTTTATGGTAAAAGGAGG - Intergenic
945465280 2:210162316-210162338 ACAGGAATTAAGGGAAAGGAAGG + Intronic
945941613 2:215956991-215957013 ACAGCAGGTAAGTGAAAAGCTGG + Intronic
947855109 2:233318735-233318757 ACACCATCTAAGGCAAAAGAGGG - Exonic
948069882 2:235112061-235112083 ACAGCATTTCAGGGTGAAGCTGG + Intergenic
948472752 2:238195587-238195609 ACAGAATTTCAGGAAAAAGCTGG - Intronic
1170108394 20:12778022-12778044 AAAACATTAAAGGGAAAGGGTGG + Intergenic
1170125639 20:12960430-12960452 ACAGGTTTTTGGGGAAAAGGTGG - Intergenic
1172018391 20:31894437-31894459 ATAGGATTTATGGGAAAAGATGG - Intronic
1173003292 20:39121014-39121036 ACAGGTTTGATGGGAAAAGGAGG - Intergenic
1173264237 20:41463909-41463931 AAAGTATTTAGGGGACAAGGGGG + Intronic
1174532709 20:51226725-51226747 ACAGCCTATAAGGGATATGGTGG + Intergenic
1174731928 20:52926471-52926493 AAAGAATTTAAGGGAAAAACTGG + Intergenic
1175101797 20:56584627-56584649 TCAACATATAAAGGAAAAGGAGG - Intergenic
1176986575 21:15444572-15444594 ACAGCATTCAAGTCAAATGGAGG - Intergenic
1177288985 21:19085778-19085800 GCACCTTTCAAGGGAAAAGGAGG + Intergenic
1177519955 21:22208385-22208407 ACAGGATTTTTGGGAAGAGGTGG + Intergenic
1180014058 21:45071585-45071607 ACTGCACTGAAGGGAAAACGTGG + Intergenic
1181178706 22:21052730-21052752 ACAACATGGAAGGGAACAGGTGG - Intronic
1183124863 22:35767203-35767225 ACAGCATTGAAAATAAAAGGGGG + Intronic
1183527960 22:38335310-38335332 ACAATATTCAAGGGAAAAGCAGG + Intronic
1183809045 22:40238510-40238532 ACAGGGTGTAAGGGAGAAGGTGG - Intronic
1183816841 22:40309138-40309160 ACAGCATTTAAGGGCATTGCAGG + Intronic
1184915291 22:47564716-47564738 ACAGCTCTTAGGGGGAAAGGAGG + Intergenic
951404059 3:22272223-22272245 AATGCATTTAAAGGATAAGGTGG - Intronic
951795834 3:26537624-26537646 GCAGAAATGAAGGGAAAAGGAGG + Intergenic
952300369 3:32099538-32099560 ACAGAATATGAGGGGAAAGGGGG - Intergenic
954920889 3:54189909-54189931 ACAGCATTTATGAGAATGGGTGG - Intronic
954932534 3:54296519-54296541 ACAGCATTTAAGTGAGAACAGGG + Intronic
954977667 3:54711906-54711928 ATAGCATTTAAAGGGAAGGGAGG - Intronic
955320433 3:57970459-57970481 AGAGCATTTAAAGGCAAAGGGGG + Intergenic
957218383 3:77350634-77350656 TCAGCATTTTAGGGAATAGTGGG + Intronic
957506115 3:81123367-81123389 AAAACATTTTAGGGAAAAGTAGG - Intergenic
960540276 3:118854360-118854382 ACAACATCAAAGGGAACAGGTGG + Intergenic
961175653 3:124832936-124832958 ACAGCACATAAGGGAAAACAAGG + Intronic
963117790 3:141747159-141747181 CCAGCATCTGAGGGAAGAGGAGG + Exonic
963304674 3:143638528-143638550 GCAGTATTGAAGGAAAAAGGAGG - Intronic
964453174 3:156832171-156832193 ACAGCACTTAAGTGAACAGGTGG + Intronic
964829466 3:160867541-160867563 TAAGCATATAAGGAAAAAGGAGG - Intronic
965531566 3:169775330-169775352 ACAGATTGTAGGGGAAAAGGTGG + Intronic
965768246 3:172154008-172154030 ACAGCACTGAAGGGAAAACTAGG - Intronic
966231625 3:177658787-177658809 CCAGCATTGCAGGGAAGAGGAGG - Intergenic
966612335 3:181880205-181880227 ATATTATTTAAGGGAAAAGCAGG + Intergenic
967478180 3:189944722-189944744 CCACCATTTTAGGGCAAAGGGGG - Intergenic
967519836 3:190416605-190416627 GCAGCATGGAAGGGAAATGGGGG - Intergenic
967760721 3:193223177-193223199 ACAGAAATGAAGGGAAAAGGAGG - Intergenic
968842814 4:3020596-3020618 CCAGCATTTAAGGGACAGGAGGG - Intronic
970438915 4:16062910-16062932 GCAACTTTTAGGGGAAAAGGGGG - Intronic
970783908 4:19772811-19772833 ACAGCATTAAAGCAAAAGGGGGG - Intergenic
971068083 4:23058109-23058131 ACAGCAGTGAAAGGAAAAAGTGG + Intergenic
976016274 4:80559390-80559412 AGAGAATATAAGGGAAGAGGTGG + Intronic
976569057 4:86587755-86587777 TCAGCCTTTGAGGTAAAAGGTGG + Intronic
977206106 4:94166816-94166838 TGACCATTTCAGGGAAAAGGTGG - Intergenic
978335629 4:107665579-107665601 CCAGCACTGAAGGGTAAAGGGGG + Intronic
978706010 4:111712492-111712514 CCAGCATCTGAGGGAAAGGGTGG - Intergenic
978762320 4:112367172-112367194 ATAGCATTTTGGGGAACAGGTGG - Intronic
978842180 4:113228203-113228225 ATAGGTTTTAAGGGAACAGGTGG + Intronic
979386346 4:120069348-120069370 ACAGCTTATAAGGATAAAGGAGG + Intergenic
980510607 4:133781817-133781839 ACAGCATTTTAGTCAAAATGAGG - Intergenic
981098679 4:140807519-140807541 ACAGGTTTTATGGGAAAAGTAGG + Intergenic
981471000 4:145134774-145134796 ACAACACCAAAGGGAAAAGGGGG + Exonic
981725471 4:147842834-147842856 CCAGCAAGGAAGGGAAAAGGTGG - Intronic
984113330 4:175646833-175646855 ACAGGAATTAGGGGATAAGGAGG - Intronic
986612165 5:9580271-9580293 ACAACGGTTAAGTGAAAAGGGGG - Intergenic
987248171 5:16070950-16070972 ACAGCATTTAAAGAAAAAGGGGG - Intronic
990162676 5:52960148-52960170 AAAACATTTATGGTAAAAGGGGG + Intergenic
991429552 5:66530049-66530071 ACAGCCTATAAGAGAAGAGGTGG - Intergenic
993041892 5:82823961-82823983 TCAGCCTTTCAGGGAAAAGCAGG + Intergenic
993138193 5:83997099-83997121 ACAGGGTTTAATGGGAAAGGTGG + Intronic
994723253 5:103404987-103405009 AAAGTATTACAGGGAAAAGGAGG - Intergenic
995029430 5:107463791-107463813 ACTGCATTTGATGGAAAAAGAGG - Intronic
995172901 5:109138118-109138140 AAAGCATGTACAGGAAAAGGAGG + Intronic
995982987 5:118130524-118130546 ACAGCATTTTAGGGAATATGGGG - Intergenic
996094922 5:119388569-119388591 AGAGGATTTAAGGAACAAGGAGG + Intronic
996593022 5:125169059-125169081 CCAGCATTTTTGGGGAAAGGTGG + Intergenic
998930647 5:147177354-147177376 ACTGCATTTCAGCGCAAAGGGGG + Intergenic
999484877 5:151985422-151985444 GCAGCCTTTCAGGGAAATGGGGG + Intergenic
999662174 5:153876521-153876543 ACTGAACTGAAGGGAAAAGGTGG - Intergenic
1001267028 5:170281070-170281092 CCAGCATTTATGGGGAGAGGAGG + Intronic
1003550799 6:7100661-7100683 AGAACAGCTAAGGGAAAAGGTGG - Intergenic
1004789441 6:19007870-19007892 ACATTGTTGAAGGGAAAAGGGGG - Intergenic
1004919172 6:20360019-20360041 ACAGCAAAACAGGGAAAAGGAGG + Intergenic
1005019420 6:21403563-21403585 GAGGCATTTAGGGGAAAAGGAGG + Intergenic
1006374748 6:33665660-33665682 AGAGCATTTCAGGGGAAAGCCGG + Intronic
1006731683 6:36240757-36240779 ATAGTATTTAGGGGAAGAGGAGG - Intergenic
1007135245 6:39514405-39514427 TCAGCATTTAAGCAGAAAGGAGG + Intronic
1007879575 6:45148821-45148843 ACAGGACTTACGGGAAAATGGGG - Intronic
1008143640 6:47862359-47862381 ACTTCAATGAAGGGAAAAGGGGG - Intergenic
1009319795 6:62273559-62273581 ACAGTATTTAAGGGAAAGACAGG - Intronic
1009849863 6:69181653-69181675 ACAACATTCTAGGCAAAAGGTGG - Intronic
1012360774 6:98376687-98376709 ACAGAATGTAAAAGAAAAGGAGG - Intergenic
1012497494 6:99850130-99850152 ACTGCCTATAGGGGAAAAGGGGG - Intergenic
1012549912 6:100456679-100456701 GCAGACTTTAAGGGAAGAGGGGG - Intronic
1013229107 6:108145332-108145354 TCAGCAGTCAAGGGGAAAGGAGG - Intronic
1013497241 6:110710110-110710132 ACACCATTTAAGAAGAAAGGCGG + Intronic
1013856461 6:114579475-114579497 AAAGCATTTCAAGGAAAAGGTGG + Intergenic
1014486425 6:122004479-122004501 ACAACAGGTAAGGGAAAGGGTGG - Intergenic
1016380846 6:143477229-143477251 ACAGTATTTAAGGGGAATGTGGG + Intronic
1016600035 6:145847799-145847821 TCAGCATTTAATGGAAAAAATGG - Intergenic
1018615926 6:165686876-165686898 ATAGCATTTAGTGGAGAAGGTGG - Intronic
1019424377 7:967035-967057 GCTTCCTTTAAGGGAAAAGGTGG + Exonic
1022071538 7:26920616-26920638 ACAGAATGTAAGGGCATAGGAGG - Intronic
1022311069 7:29195988-29196010 ACAGTATTTAAGGGTCAAGAAGG + Intronic
1024935935 7:54712393-54712415 ACAACATTTATGAGAAAAGTTGG - Intergenic
1025959845 7:66210274-66210296 ACAAATTTTGAGGGAAAAGGAGG + Intronic
1027185404 7:75968041-75968063 CCAGGACTTAAGGAAAAAGGAGG - Intronic
1027501228 7:78953886-78953908 AAAGTATTTAAGTGAAAAAGAGG + Intronic
1027907467 7:84204342-84204364 ACAGCCATGATGGGAAAAGGGGG - Intronic
1028050843 7:86183954-86183976 CAAGCATTAAAGGCAAAAGGAGG + Intergenic
1028825692 7:95271025-95271047 AAAGCACTTAAGGGAAAAAAAGG + Intronic
1028951780 7:96644435-96644457 ATAGCATTAAAGGGGGAAGGTGG + Intronic
1030071554 7:105702409-105702431 ACAGCTTTGAAAGTAAAAGGGGG + Intronic
1031042188 7:116850017-116850039 ACAGGACTTAAGGGAACATGTGG + Intronic
1031453037 7:121945684-121945706 ACAGAATTTAAAGGAGAAGTAGG - Intronic
1031652085 7:124303585-124303607 ACAGCATGGAAGGGAAATGTGGG + Intergenic
1031972597 7:128075180-128075202 ACCGCATTGAAGAGACAAGGGGG + Intronic
1033254442 7:139787748-139787770 ACACCAGGTAAGGGAAAATGGGG - Intronic
1033322135 7:140349521-140349543 TCAGCATCAAAGGAAAAAGGGGG + Intronic
1036500130 8:9306297-9306319 ATATTCTTTAAGGGAAAAGGTGG + Intergenic
1037090905 8:14917178-14917200 TCAGCTTTATAGGGAAAAGGAGG + Intronic
1037108413 8:15137816-15137838 ACAGCATGGAAGGGAAATGTGGG + Intronic
1039518702 8:38153444-38153466 ACAGCTTTTAAGGGGGAAAGTGG - Intergenic
1039638786 8:39195256-39195278 ATCGCATTTAAGGGGAGAGGTGG - Intronic
1041639707 8:60183820-60183842 ACAGCATTCTAAGGAAAATGAGG + Intergenic
1042092585 8:65174976-65174998 ACAGCATGTTTGGGAAAAGGTGG - Intergenic
1042832020 8:73041006-73041028 AAAGGATTTAATGGAAAAAGTGG - Intronic
1043453195 8:80389272-80389294 ACAGAATTTCTGGGAAAATGGGG + Intergenic
1044414107 8:91916841-91916863 ACAGCAATTTTGGAAAAAGGAGG - Intergenic
1044880272 8:96716345-96716367 ATAGATTTTAAGGGAACAGGTGG + Intronic
1048178883 8:132177457-132177479 AATGGATTTAAGGGACAAGGAGG - Intronic
1050789840 9:9453745-9453767 TTTGGATTTAAGGGAAAAGGAGG + Intronic
1051536097 9:18159935-18159957 ACTTCATTAAAGGGAAAATGAGG - Intergenic
1052124534 9:24759036-24759058 ACAGCATTAGAGAGAAAAAGCGG + Intergenic
1052819491 9:33127762-33127784 AAAGAATTTAAGGAAAAAGCAGG + Intronic
1053597817 9:39581263-39581285 CCAGCTTTCAAGGGAAAAGAAGG + Intergenic
1053855838 9:42338267-42338289 CCAGCTTTGAAGGGAAAAGAAGG + Intergenic
1054747050 9:68865082-68865104 AGAGCATTTAAAGCAAAACGAGG - Intronic
1054823794 9:69550319-69550341 AGAGCATTTAAAAGGAAAGGAGG - Intronic
1056342911 9:85655625-85655647 AGATAATTTAAGGGAAAAGGGGG + Intronic
1056431788 9:86535204-86535226 ACAGATTTTAAGGGAAAGGAAGG - Intergenic
1058084837 9:100737820-100737842 ACAGCAGTTAAGAGACAAAGAGG - Intergenic
1058306604 9:103450587-103450609 ATAGCATTTAATGGTAAATGAGG - Intergenic
1058640315 9:107077579-107077601 ACAACATCTAAGTGAAAATGTGG - Intergenic
1059170932 9:112123901-112123923 ACCGCTTTTCAGAGAAAAGGTGG - Intronic
1059613590 9:115924973-115924995 AAAGCATTTTAAGGACAAGGAGG - Intergenic
1062272364 9:135715347-135715369 ACAGCTATTTGGGGAAAAGGAGG - Intronic
1188029498 X:25248532-25248554 TCAGCCTTTGAGGGAGAAGGAGG - Intergenic
1188204329 X:27334512-27334534 TCAGCATTTTAGGGAAAATTTGG + Intergenic
1189925527 X:45949833-45949855 ACAGAATTGAAGGGAGAAGGTGG - Intergenic
1189996964 X:46648089-46648111 TCAGCTTTACAGGGAAAAGGGGG + Intronic
1190135719 X:47795725-47795747 ACAGTTTTTAAGAAAAAAGGAGG + Intergenic
1190465482 X:50721807-50721829 ACAGTATTTAAGGGCTATGGGGG - Intronic
1195976859 X:110536004-110536026 ATAGCTTTTAAGGGGAAGGGAGG + Intergenic
1196070292 X:111513323-111513345 AAAGCTGTTGAGGGAAAAGGAGG - Intergenic
1197416288 X:126177413-126177435 ACAGCTTATATGGGAAAATGTGG - Intergenic
1198019590 X:132644918-132644940 ACAACTTGTAAGGGTAAAGGAGG + Intronic
1198335028 X:135657545-135657567 ACTGAATTTAAGGGAATATGGGG - Intergenic
1198672622 X:139097529-139097551 CCTGAATTTAAAGGAAAAGGTGG + Intronic
1198974595 X:142322019-142322041 ACAGCATTTAAGGCACTTGGTGG + Intergenic
1201724956 Y:17141138-17141160 ACACAGTTTAAGGGAGAAGGGGG + Intergenic