ID: 1065376544

View in Genome Browser
Species Human (GRCh38)
Location 10:25048999-25049021
Sequence AGAATAGCGATTAAGAAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065376542_1065376544 -1 Left 1065376542 10:25048977-25048999 CCTTCTAGGAGGCTGTATATAAA 0: 1
1: 0
2: 0
3: 7
4: 135
Right 1065376544 10:25048999-25049021 AGAATAGCGATTAAGAAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065376544 Original CRISPR AGAATAGCGATTAAGAAGGC TGG Intronic
No off target data available for this crispr