ID: 1065377290

View in Genome Browser
Species Human (GRCh38)
Location 10:25056302-25056324
Sequence CATTGAGCTGAGAACTTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 187}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065377290_1065377296 16 Left 1065377290 10:25056302-25056324 CCCCAGAAGTTCTCAGCTCAATG 0: 1
1: 0
2: 0
3: 14
4: 187
Right 1065377296 10:25056341-25056363 CGCAGAATCAATTCCAATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065377290 Original CRISPR CATTGAGCTGAGAACTTCTG GGG (reversed) Intronic
900815735 1:4842714-4842736 CATTGAGCTGAGAAGCCCAGTGG + Intergenic
901528938 1:9841848-9841870 CAAAGAGCTGGGAATTTCTGGGG + Intergenic
905758447 1:40532562-40532584 CTATGAGCTTAGAACTGCTGGGG - Intronic
907493644 1:54826808-54826830 AATTCAGCATAGAACTTCTGAGG - Intronic
908425083 1:63999317-63999339 CAGTGAGCTGAGACCTGGTGAGG - Intronic
908836488 1:68233346-68233368 CACTGAGCTGTAAACTCCTGGGG + Intergenic
908938189 1:69400801-69400823 GATTGTGCTGACAAATTCTGTGG + Intergenic
909911328 1:81261102-81261124 CATTGAGAAGACAACATCTGAGG - Intergenic
911360394 1:96868909-96868931 CATTGAGTGGAGAACGTCTTTGG - Intergenic
915810041 1:158899309-158899331 CTTGGAGCAGAGAACATCTGGGG - Intergenic
915831495 1:159135032-159135054 CATGGAGCAAAGAAGTTCTGTGG - Intronic
915986664 1:160472828-160472850 TACTGAGCTGAGAAATACTGTGG + Intergenic
922133035 1:222797881-222797903 CATTCACCTGAAAACTTCAGGGG + Intergenic
922533124 1:226359648-226359670 CAGTGAGCTGAGATCATGTGTGG - Intergenic
922616680 1:226965021-226965043 TATTTTGCTGAGAACTTCGGCGG + Exonic
1063516553 10:6701843-6701865 CCTTGTGCTAAGTACTTCTGTGG - Intergenic
1064294220 10:14063878-14063900 TAGTGAGCTGAAAACTCCTGGGG - Intronic
1065377290 10:25056302-25056324 CATTGAGCTGAGAACTTCTGGGG - Intronic
1068290304 10:54993299-54993321 CATAGAACTGAAAGCTTCTGAGG + Intronic
1068670514 10:59717642-59717664 CATGGAGATGAGAACTTCCATGG - Intronic
1070779266 10:79128013-79128035 CCTTGCGCTGAGAACTTCCTAGG + Intronic
1072112341 10:92334786-92334808 AAGTGAGCTGAGAACTACTGGGG - Intronic
1073614398 10:104978437-104978459 CATTGAGTTGAGAGGTTTTGAGG - Intronic
1074425294 10:113345552-113345574 TAATGTGCTGAGAACTTTTGAGG + Intergenic
1076094474 10:127720178-127720200 CATGGTGCTGAGAGCTTCTCTGG + Intergenic
1078001212 11:7497594-7497616 CATCAAGTTGAGAACTTCAGTGG - Intronic
1078955368 11:16188272-16188294 CATTGAGCTCAGTAAATCTGAGG - Intronic
1081003688 11:37706533-37706555 CAGTGAGATGAAAACTGCTGAGG - Intergenic
1081838903 11:46181147-46181169 CATTGAGTTGAGAACTTGACTGG - Intergenic
1089456092 11:118626715-118626737 CAGTGAGCTGAGAACTGCCTGGG - Intronic
1089751930 11:120657860-120657882 CACTGAGCTGTAAACTTATGGGG - Intronic
1090112548 11:123929495-123929517 CATTGAGCTTATAATTTCAGAGG - Intergenic
1090491186 11:127162332-127162354 CATTGAGCTAAGAACCCCAGGGG + Intergenic
1090697276 11:129260007-129260029 CAGTGACCTTTGAACTTCTGTGG - Intronic
1091651021 12:2310063-2310085 CAGTGAGCTGAGCAGCTCTGCGG - Intronic
1091946582 12:4550426-4550448 CTTTGAGCGGAGAGCTTCTTAGG + Intronic
1092586716 12:9908158-9908180 CATAAAGCTGAAAACTGCTGGGG - Intronic
1092990798 12:13897205-13897227 GACTGAACTGAGAAGTTCTGAGG - Intronic
1096409845 12:51369184-51369206 CACTGAGCTGTGAACCTCAGGGG + Intronic
1096543318 12:52320834-52320856 CTTTGGCCTGGGAACTTCTGTGG + Intronic
1099125613 12:78753086-78753108 CTTTGTGCTGTGAAGTTCTGTGG - Intergenic
1102299667 12:111762030-111762052 CATGGTGCTGAGACCTTCGGTGG - Intronic
1102409616 12:112706352-112706374 CATTGCACTGAGGAGTTCTGGGG - Intronic
1104043787 12:125147314-125147336 CACTGAACTGAGAACCACTGAGG - Intergenic
1104164879 12:126218078-126218100 CATTGAGCACACATCTTCTGGGG + Intergenic
1106457770 13:29942433-29942455 CACTGTACTGAGAGCTTCTGAGG - Intergenic
1107170122 13:37331727-37331749 CCTTTAGCTCAGAACTTCTCTGG + Intergenic
1110324482 13:74198397-74198419 CATTGAACGGAGCACTTCTCTGG - Intergenic
1110830705 13:80027246-80027268 CATTTATGTGAGAACTTATGAGG - Intergenic
1112018538 13:95351681-95351703 CTTTGAGCTGAGGTCTTCTGAGG + Intergenic
1112830390 13:103442488-103442510 AACTGAGATGAGAATTTCTGTGG - Intergenic
1114570382 14:23663098-23663120 CACTGTGCTGAGAACTTCACAGG - Intergenic
1117067055 14:52021647-52021669 CATTGAGTTCAGAATTTTTGGGG - Intronic
1117444198 14:55788117-55788139 TATTGAGTTGAAAACATCTGCGG - Intergenic
1117527208 14:56620724-56620746 GATGGAGCTGAGAATATCTGGGG - Intronic
1122930413 14:104930859-104930881 AAGTGAGATGAGAAGTTCTGAGG - Exonic
1124614376 15:31230967-31230989 CATGGCGCTGAGAACGTATGTGG - Intergenic
1124928433 15:34095470-34095492 CATTGATCTGGAAATTTCTGTGG - Intronic
1128734727 15:70046820-70046842 CCTTGAACTGTGAGCTTCTGTGG + Intergenic
1130792715 15:87172722-87172744 CATTTAGCTGAGAAGTATTGAGG - Intergenic
1132168237 15:99619158-99619180 CAGTGAGATGAGGATTTCTGTGG + Intronic
1136673444 16:31878051-31878073 GACTGAGCCGAGAACTTGTGGGG + Intronic
1137372826 16:47924269-47924291 CATTGAGCTGACCATTGCTGTGG - Intergenic
1141012702 16:80417809-80417831 CCTTGAGTTGAGTTCTTCTGAGG + Intergenic
1141449763 16:84090665-84090687 CCTTGAGGTGACAACTGCTGAGG + Intronic
1142239232 16:88937604-88937626 CTGTGAGCTAGGAACTTCTGTGG + Intronic
1147002594 17:37374756-37374778 CATTGGGCTGAGAGGTTGTGAGG - Intronic
1147513195 17:41090530-41090552 CATTTAGCTGACAACTTCCTAGG + Intronic
1148850207 17:50550911-50550933 CAGTCAGGTGAGGACTTCTGGGG + Exonic
1151811648 17:76446710-76446732 AATGGAGCTGACCACTTCTGAGG + Intronic
1152495518 17:80668600-80668622 CATACGGCTGAGAACTGCTGAGG - Intronic
1152530137 17:80913837-80913859 CACTGAGGTGAGAACTGCTGGGG - Intronic
1154273641 18:12941032-12941054 CATTGAGCTCCTAAATTCTGTGG - Intergenic
1155646497 18:28084763-28084785 CAGGAAGCTGAAAACTTCTGGGG + Intronic
1155867623 18:30985209-30985231 AAATGGGCAGAGAACTTCTGGGG - Intergenic
1156483166 18:37448750-37448772 CAGTGGGCTGAGCACTTCTTGGG - Intronic
1157291680 18:46414070-46414092 GATTCAGATGAGAACTGCTGGGG - Intronic
1157811073 18:50696405-50696427 CACTGAGCTGAGCACTGTTGGGG + Intronic
1159496038 18:69206522-69206544 CATTTAGCAGAGAACTTTGGAGG - Intergenic
1159704090 18:71665257-71665279 CATTGATCACAGAACTTCTGGGG + Intergenic
1163546844 19:17945753-17945775 CACAGAGCTGAGGACCTCTGTGG - Intergenic
1164512443 19:28908648-28908670 TCTTGAGCTGTGAACTTGTGAGG + Intergenic
1165614223 19:37184552-37184574 CAATGTGCTGAGAACCTGTGGGG + Exonic
1165727112 19:38120780-38120802 CATTGTGCTGAGAAGTACTCAGG + Intronic
1165824725 19:38699166-38699188 AACTGATCTGAGATCTTCTGTGG + Intronic
925825770 2:7847115-7847137 CATTGAGGTAAGAAATTATGGGG - Intergenic
926071062 2:9891645-9891667 CATGGAGCTGTCATCTTCTGTGG - Intronic
926875792 2:17477271-17477293 CATTGAGCTGACAACAGCTCTGG + Intergenic
929376966 2:41299253-41299275 CATTGGGCTGAGGACCTCTCAGG + Intergenic
931393209 2:61862759-61862781 CATTTAACTGGGAACATCTGGGG - Intergenic
933764742 2:85698993-85699015 CACTGGTCTGAGAGCTTCTGGGG - Intergenic
943069500 2:183124268-183124290 CTTTGCGCTGAGAATTTCCGAGG - Intronic
943234506 2:185300509-185300531 TATTGAGCTGAAATCTTCTGTGG - Intergenic
945981489 2:216316041-216316063 CATTGAGCAGAGGGCTTATGTGG - Intronic
946194410 2:218024539-218024561 CACTGAGCTGAGGCCATCTGTGG - Intergenic
946359187 2:219208877-219208899 CATGGTGCTGAGCACTGCTGAGG - Intronic
946484318 2:220086332-220086354 GATTGTGCAGAGAACGTCTGAGG + Intergenic
1170087063 20:12545292-12545314 CATGGTGCTGAGAACATCTCTGG - Intergenic
1170272839 20:14547803-14547825 CATTCAGCTGAGAACTTAAGAGG + Intronic
1170446595 20:16434314-16434336 CATTGAGCCGAGTCCTCCTGTGG - Intronic
1170653042 20:18260305-18260327 CAATGAGCTGAGAAAGTTTGGGG - Intergenic
1170882637 20:20310712-20310734 CATGGAGCTGGCAACTTTTGTGG - Intronic
1172746834 20:37217238-37217260 CACTGGGCTGAGAACTCCTATGG + Intronic
1173029419 20:39341087-39341109 CATTTAGCTGAGAACTTAAAAGG + Intergenic
1175981319 20:62740100-62740122 CATGGAGCAGAGAACTTTTCCGG + Intronic
1176263228 20:64194315-64194337 CAGTGACCTGAGGACATCTGGGG - Intronic
1176695392 21:9971563-9971585 CTTTGGGCTGATAAATTCTGTGG - Intergenic
1178426437 21:32482659-32482681 CATTGGGCTGACAGCTGCTGGGG - Intronic
1183762316 22:39832991-39833013 CAAGGAGCTGAGAAAATCTGGGG + Intronic
950341153 3:12245920-12245942 CATTGAGCATAGAACTTTTCAGG + Intergenic
953130357 3:40132319-40132341 CATTTATTTGAGAACTTCTTAGG - Intronic
954281023 3:49577948-49577970 GAGTGAGCTGAGAACTGCTGGGG + Intronic
954648944 3:52148375-52148397 TATTGAGCTGTGTTCTTCTGGGG - Intronic
955251616 3:57288610-57288632 CATTGAGCTGAACACTACAGGGG - Intronic
955516654 3:59732584-59732606 CAGTTAGCTGAGAAGCTCTGGGG - Intergenic
956083179 3:65581385-65581407 TTTTGAGCAGAGAACTTCCGTGG - Intronic
956260361 3:67332992-67333014 TATTGAGCTGATCACTTCTAGGG - Intergenic
961758371 3:129145692-129145714 GAATGAGCTGGGAACTGCTGTGG + Intronic
962235549 3:133704148-133704170 CAGTGAAATGAGAACCTCTGAGG + Intergenic
964735376 3:159911859-159911881 CATTGGCCCTAGAACTTCTGAGG - Intergenic
965707801 3:171526563-171526585 AATGAAGTTGAGAACTTCTGTGG - Intergenic
970588463 4:17537240-17537262 TCTGGTGCTGAGAACTTCTGTGG - Intergenic
972879448 4:43406163-43406185 GATGGAGATGAGAACTTCTTGGG + Intergenic
973024626 4:45251765-45251787 CATTGAACTGAGAATTCCTGAGG + Intergenic
974337918 4:60575440-60575462 AACAGAGCTGAGAACTACTGTGG + Intergenic
975484451 4:74919071-74919093 TATTGAGCTGTGGAATTCTGTGG - Intergenic
975769922 4:77709806-77709828 TATTGAGCTGATCACATCTGTGG - Intergenic
976367281 4:84245495-84245517 AACTGAGCTGAGGACCTCTGTGG - Intergenic
979449849 4:120857671-120857693 AATTGAGCTGAGATTTTTTGTGG - Intronic
980368022 4:131831810-131831832 CTTTGGGCTGATAAATTCTGTGG - Intergenic
980531530 4:134062202-134062224 ATTGGAGCTGAGAATTTCTGAGG + Intergenic
981054224 4:140343463-140343485 CACTCAGGTGAGAACTTCTCAGG + Intronic
982762839 4:159307893-159307915 CACTGCTCTGACAACTTCTGGGG - Intronic
984614652 4:181883255-181883277 CATTGTGCTAAGAACCTGTGTGG + Intergenic
985209297 4:187574854-187574876 CATTCTGCTTAGAACTTCTTTGG - Intergenic
986329576 5:6707613-6707635 TATTGAGCTGAGAGCTTCTTTGG + Intergenic
987723341 5:21665515-21665537 AATTGAGATGAGCACTACTGGGG + Intergenic
988267400 5:28969054-28969076 CAGTGAGCTGAGAACATCAAGGG - Intergenic
988628490 5:32902275-32902297 GATTTTGCTGGGAACTTCTGAGG + Intergenic
988997691 5:36730282-36730304 CAGGGAGCTCAGAATTTCTGAGG + Intergenic
990186064 5:53211348-53211370 CATTTAGCTGACAACTGCTTAGG - Intergenic
991226747 5:64282152-64282174 AATTCAGCTGTGAACTTCTCTGG + Intronic
994866928 5:105285768-105285790 CATAGACCTGAGAACCTGTGGGG - Intergenic
995011874 5:107265441-107265463 TATTGATCTGAGAGCATCTGTGG - Intergenic
995627493 5:114095279-114095301 CATTTTGCTGAGCACTTGTGAGG + Intergenic
996807667 5:127475686-127475708 CCTTGAGCTGTGAACTTCACAGG + Intergenic
1000205902 5:159058400-159058422 CCTTCAGCTGAGAACTTCCCTGG - Intronic
1006686429 6:35838398-35838420 CATTGATCATAGAACTTCTGGGG - Exonic
1007387115 6:41527777-41527799 CATTGAGCTGGGAGCCTCTCAGG + Intergenic
1008402067 6:51075186-51075208 AATTGAGCTGTGAAGCTCTGTGG + Intergenic
1012114452 6:95277938-95277960 CTGTGACCTGAGAAATTCTGAGG + Intergenic
1012475410 6:99611290-99611312 CATTGAGCTGAGTCATTCTGCGG + Intronic
1013268641 6:108525067-108525089 GTTTGAGCTGAGTACTGCTGTGG + Exonic
1013777309 6:113692658-113692680 CATTGACCTGTGTCCTTCTGAGG - Intergenic
1014315038 6:119853354-119853376 TAATGAGCTGTGAATTTCTGAGG + Intergenic
1017835301 6:158171888-158171910 CAGTGTGTTTAGAACTTCTGGGG - Intronic
1018103723 6:160464103-160464125 TTTTGAGCTGAGTGCTTCTGGGG - Intergenic
1018112021 6:160545334-160545356 TTTTGAGCTGAGTGCTTCTGGGG - Intronic
1018247418 6:161836178-161836200 CATTGAGACCAGAACTACTGAGG - Intronic
1024972793 7:55086127-55086149 TATTGAGCAGAGAAATTGTGAGG - Intronic
1025950538 7:66141924-66141946 CAAGGAGCTGAGCACTGCTGTGG - Intronic
1029599115 7:101553520-101553542 CATGGGGCTGTGAACTTCTCAGG - Intronic
1029599252 7:101554082-101554104 CACTGGGCTGTGAACTTCTCAGG - Intronic
1030507281 7:110441027-110441049 CACTGAGCTGAGAATGTCTATGG - Intergenic
1032243000 7:130180424-130180446 CAGTGAGCCGAGATCGTCTGGGG - Intronic
1034943621 7:155248174-155248196 CCCTGAGCTGAGGACATCTGGGG - Intergenic
1035848605 8:2891513-2891535 CAGTGTGCTGAGGAGTTCTGTGG + Intergenic
1036493386 8:9248286-9248308 CAATTAGCTGAAAACTTCTTTGG + Intergenic
1036599495 8:10247311-10247333 CTTTGAGCTGAGAGCTAATGAGG - Intronic
1037340175 8:17835964-17835986 CAAAGAGCTAAGAACTTCTCGGG + Intergenic
1039872207 8:41555934-41555956 CATTCAGTTGACTACTTCTGTGG - Intergenic
1041453496 8:58032837-58032859 CCCTAAGCTGAGAACTTCTGTGG + Intronic
1042813936 8:72857277-72857299 CATTGAGGTGAGAACTGAAGGGG + Intronic
1043711032 8:83419429-83419451 CATAGAGCTTAGACCTTTTGCGG + Intergenic
1044291077 8:90471268-90471290 CATTGAGCAGAGATCCTCAGAGG + Intergenic
1044542842 8:93427131-93427153 CAATGAGCTACGAACTTCTTGGG - Intergenic
1046457318 8:114483887-114483909 AATTGAGTGGAGCACTTCTGTGG + Intergenic
1048810245 8:138279165-138279187 CACTGAGGGAAGAACTTCTGAGG - Intronic
1049401853 8:142431490-142431512 CCTTGGGCTGAGACCCTCTGGGG + Intergenic
1050813861 9:9783871-9783893 CACTGAGCTGATAAGTACTGTGG - Intronic
1050977076 9:11952273-11952295 TATTGAGCTCAGAATTTATGTGG - Intergenic
1051421572 9:16894276-16894298 CATTGCCCTGAGAACATGTGAGG + Intergenic
1053632373 9:39957515-39957537 CTTTGGGCTGATAAATTCTGTGG - Intergenic
1053773387 9:41506016-41506038 CTTTGGGCTGATAAATTCTGTGG + Intergenic
1054211515 9:62293182-62293204 CTTTGGGCTGATAAATTCTGTGG + Intergenic
1054313470 9:63555664-63555686 CTTTGGGCTGATAAATTCTGTGG - Intergenic
1055844479 9:80544813-80544835 GATTGAGATGAGAACATCTTTGG + Intergenic
1055986578 9:82060459-82060481 CTAAGATCTGAGAACTTCTGAGG + Intergenic
1056534420 9:87515702-87515724 AATTGAGCTGATAGCCTCTGAGG + Intronic
1058395000 9:104541557-104541579 CTTAGAGCTGAAAACTTCTGCGG + Intergenic
1058553576 9:106141505-106141527 CATCGGGCTGATTACTTCTGTGG + Intergenic
1060778332 9:126393017-126393039 CAGTAAGCAGAGAACTGCTGAGG + Intronic
1061047143 9:128172062-128172084 CCTTGAGCTCAGGAGTTCTGAGG + Intronic
1062268518 9:135698443-135698465 CGTTGAGCTGTGAGCGTCTGCGG - Exonic
1186896444 X:14008905-14008927 CCCTGAGCTCAGAACTTCAGGGG + Exonic
1187106896 X:16252630-16252652 CATTGAGATGATAACGTCTGAGG + Intergenic
1189371927 X:40435522-40435544 TTTTGAGTTAAGAACTTCTGGGG + Intergenic
1192326104 X:70133635-70133657 CACGGGGCTGAGAAGTTCTGTGG - Exonic
1194120080 X:89950832-89950854 TATTGGGCTGATAACTTATGTGG - Intergenic
1199983855 X:152936602-152936624 CATGGAGCTGAGAAGTTCGAGGG - Intronic
1200472942 Y:3608350-3608372 TATTGGGCTGATAACTTATGTGG - Intergenic
1202023661 Y:20495648-20495670 CCTTGAGTTGAGAACTTGTTTGG - Intergenic