ID: 1065381179

View in Genome Browser
Species Human (GRCh38)
Location 10:25091998-25092020
Sequence GTCTCCCAGGAAAGAACACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065381179_1065381182 30 Left 1065381179 10:25091998-25092020 CCAGGTGTTCTTTCCTGGGAGAC No data
Right 1065381182 10:25092051-25092073 TTATTGGTCTGTACAGATTTTGG No data
1065381179_1065381181 14 Left 1065381179 10:25091998-25092020 CCAGGTGTTCTTTCCTGGGAGAC No data
Right 1065381181 10:25092035-25092057 TTGCTCTCATTATTTGTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065381179 Original CRISPR GTCTCCCAGGAAAGAACACC TGG (reversed) Intergenic
No off target data available for this crispr