ID: 1065382216

View in Genome Browser
Species Human (GRCh38)
Location 10:25101936-25101958
Sequence GCTAATTAGCATCTGTAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065382209_1065382216 24 Left 1065382209 10:25101889-25101911 CCAGTCATTTCAGGTCAGGGCTG No data
Right 1065382216 10:25101936-25101958 GCTAATTAGCATCTGTAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065382216 Original CRISPR GCTAATTAGCATCTGTAGGC AGG Intergenic
No off target data available for this crispr