ID: 1065383375

View in Genome Browser
Species Human (GRCh38)
Location 10:25111687-25111709
Sequence AGAGAGAAGCAGGATGAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065383375_1065383378 21 Left 1065383375 10:25111687-25111709 CCCATCTCATCCTGCTTCTCTCT No data
Right 1065383378 10:25111731-25111753 TTTTTTTTTTTTTTGAAACAAGG 0: 507
1: 14927
2: 19588
3: 42881
4: 170274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065383375 Original CRISPR AGAGAGAAGCAGGATGAGAT GGG (reversed) Intergenic
No off target data available for this crispr