ID: 1065390387 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:25175993-25176015 |
Sequence | TCTCCTCGCGCGTGGCCTGG AGG (reversed) |
Strand | - |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 93 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 7, 4: 84} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1065390387_1065390394 | 22 | Left | 1065390387 | 10:25175993-25176015 | CCTCCAGGCCACGCGCGAGGAGA | 0: 1 1: 0 2: 1 3: 7 4: 84 |
||
Right | 1065390394 | 10:25176038-25176060 | GTCCTCCTCCGCACCCCACCTGG | 0: 1 1: 1 2: 5 3: 20 4: 256 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1065390387 | Original CRISPR | TCTCCTCGCGCGTGGCCTGG AGG (reversed) | Exonic | ||