ID: 1065390387

View in Genome Browser
Species Human (GRCh38)
Location 10:25175993-25176015
Sequence TCTCCTCGCGCGTGGCCTGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 84}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065390387_1065390394 22 Left 1065390387 10:25175993-25176015 CCTCCAGGCCACGCGCGAGGAGA 0: 1
1: 0
2: 1
3: 7
4: 84
Right 1065390394 10:25176038-25176060 GTCCTCCTCCGCACCCCACCTGG 0: 1
1: 1
2: 5
3: 20
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065390387 Original CRISPR TCTCCTCGCGCGTGGCCTGG AGG (reversed) Exonic
900088759 1:910241-910263 TCTCCGCGGGCGCGGCCTCGGGG - Intergenic
900183942 1:1324435-1324457 CCTCCCCGCGCGGGCCCTGGTGG - Intronic
901532665 1:9863435-9863457 TCTCCCCGCATGTGGCTTGGAGG - Intronic
901840241 1:11949766-11949788 TCTCCAGGCGCTTGGCCTAGGGG + Exonic
902920776 1:19665107-19665129 CCTCTTCCCGCGGGGCCTGGCGG + Intergenic
905692679 1:39954905-39954927 TTTCCTCGCGCGTGTCTGGGAGG + Intergenic
915328247 1:155092367-155092389 TCTCCTCCGGTGTGGCCTGGGGG + Intergenic
917927871 1:179803975-179803997 CCTCCTGCCGCCTGGCCTGGAGG - Intronic
918340039 1:183560728-183560750 TGTGCTGGCCCGTGGCCTGGAGG + Intronic
920704517 1:208241955-208241977 TCTCCTTGGTGGTGGCCTGGAGG - Intronic
923686234 1:236155553-236155575 TCTCCTCGCGGGCTGCCTGCTGG + Intronic
1065390387 10:25175993-25176015 TCTCCTCGCGCGTGGCCTGGAGG - Exonic
1071087682 10:81882195-81882217 TTTCCTTGAGCTTGGCCTGGTGG + Intronic
1073770244 10:106727905-106727927 TCTCCTCACTCGTTGCCTGCAGG - Intronic
1075280303 10:121133132-121133154 TCTCCTCCTTCTTGGCCTGGAGG + Intergenic
1076727221 10:132419470-132419492 TCTCCTGGTGGGGGGCCTGGAGG + Intergenic
1076727278 10:132419585-132419607 TCTCCTGGGGGGGGGCCTGGAGG + Intergenic
1076909526 10:133379988-133380010 TCCCCTCGCAGGTGGCGTGGTGG + Exonic
1077516028 11:3002688-3002710 TCTCCTAGGGCCTGGCATGGAGG + Intronic
1089134098 11:116235489-116235511 TCTCTTAGCGCATGGGCTGGAGG - Intergenic
1092844111 12:12568242-12568264 TCTCCTCCTTCTTGGCCTGGAGG + Intergenic
1099729634 12:86484308-86484330 TCTGCTCTCTCTTGGCCTGGTGG - Intronic
1110648720 13:77918828-77918850 TCTTCCCCCGCGTGGCCAGGAGG + Intronic
1113293146 13:108927705-108927727 TGTCCTTGCGCATGCCCTGGAGG + Intronic
1119319086 14:73718866-73718888 TCTCCTCCCGCAGGGCCTGCTGG + Exonic
1124023535 15:25944639-25944661 GCTCCTCCAGCGTGGCCAGGAGG + Intergenic
1130647424 15:85741288-85741310 CCTCCTCGCGCTGGGCCAGGAGG - Exonic
1132843366 16:1989379-1989401 GCTCCTTGCCCGTGGCCAGGTGG - Intergenic
1142104907 16:88297458-88297480 TCTGCCCACACGTGGCCTGGAGG + Intergenic
1144019651 17:11229072-11229094 TCTTCTCACACTTGGCCTGGTGG + Intergenic
1146952625 17:36917310-36917332 TCTCCTCTCTCTTGGCCAGGTGG + Intergenic
1147260048 17:39204585-39204607 TCTCCTCCTTCTTGGCCTGGAGG - Exonic
1151209422 17:72533267-72533289 CCTCCTCGGGAGTGGCCTGAAGG + Intergenic
1152797699 17:82316221-82316243 CCTCCTCGGGCTGGGCCTGGGGG - Exonic
1152944140 17:83189929-83189951 GCTGCACGCCCGTGGCCTGGTGG - Intergenic
1162262986 19:9547711-9547733 TCTCCTCAAGTGTGGCCAGGTGG - Intergenic
1164683665 19:30152714-30152736 TCTCCTTTCGTGTGGCCTGAAGG - Intergenic
1164928005 19:32145663-32145685 TCTCCTTGCCAGTGGCCTTGTGG - Intergenic
928242969 2:29602460-29602482 TCTCCAAGCAGGTGGCCTGGTGG - Intronic
935687322 2:105695761-105695783 CCTCCTCCCGCCAGGCCTGGAGG - Intergenic
936161275 2:110085866-110085888 TCGCCTCCTGCGTGGCCTGAGGG + Intronic
936183388 2:110285488-110285510 TCGCCTCCTGCGTGGCCTGAGGG - Intergenic
938333218 2:130463589-130463611 TCTTCTCGCGGTTGGCCTTGGGG + Exonic
938356594 2:130657082-130657104 TCTTCTCGCGGTTGGCCTTGGGG - Exonic
938433026 2:131263888-131263910 TCTTCTCGCGGTTGGCCTTGGGG - Exonic
942578522 2:177392454-177392476 TGTCCTCGGGTGTGGCCTGGGGG - Intronic
944440545 2:199739237-199739259 TCTCCTCTCCAGTGGCCTTGAGG - Intergenic
948851660 2:240711315-240711337 TCTCCTGGCTGGGGGCCTGGCGG + Intergenic
948958541 2:241314935-241314957 CTCCCTCCCGCGTGGCCTGGAGG - Intronic
1176121048 20:63454763-63454785 CCTCCTCTCCCGAGGCCTGGGGG - Intronic
1179845272 21:44107568-44107590 TCTGCGCGCCCGTGGCCTCGGGG + Intronic
1179882813 21:44300487-44300509 CCTCCGCTCGCGTGGCCTCGGGG - Intronic
1180715095 22:17866200-17866222 TCTCCTCTCCCTTGGCCTGAAGG + Intronic
1181006522 22:20016326-20016348 TCTCTTTGTGCGTGGCCTTGGGG - Intronic
1183621202 22:38973843-38973865 TCTCCTCCAGTGTGGCCTGGGGG - Intronic
1183647443 22:39134701-39134723 TCTCCTTGCCCTTGGCCTTGTGG + Exonic
1183744697 22:39685814-39685836 TGTCCTCGAGCGTGGTCTGCAGG - Exonic
1183930823 22:41235181-41235203 TCTCCTGGCACTGGGCCTGGAGG + Exonic
960265422 3:115615706-115615728 ACTCCTAGCACCTGGCCTGGTGG - Intergenic
961862490 3:129927743-129927765 TCTCCTCTGTCGTGTCCTGGCGG - Intergenic
963981918 3:151547551-151547573 TCTCCTAGAGCCTGGACTGGAGG + Intergenic
968271494 3:197406917-197406939 TCTCCTCGGGCCAGGCATGGTGG - Intergenic
968668545 4:1834910-1834932 TCTCCTCGATGGTGTCCTGGAGG + Exonic
977137162 4:93319727-93319749 TCTCCTAGCGCCTTTCCTGGAGG - Intronic
978857292 4:113407624-113407646 TCTCCTCGCCATTGGCCAGGTGG - Intergenic
979128342 4:117006297-117006319 TCTCCTTTCCCATGGCCTGGTGG + Intergenic
985639585 5:1057443-1057465 TGTCCGTGCGTGTGGCCTGGGGG - Intronic
985661923 5:1161687-1161709 TCTACTCCCGCGTGGTCTGTTGG + Intergenic
986286997 5:6366496-6366518 TCTCCTGCCCCATGGCCTGGTGG + Intergenic
986851188 5:11816173-11816195 TCTCCTCGCCCTGGGCGTGGTGG - Intronic
996962482 5:129268267-129268289 TCTACTCTCTCCTGGCCTGGAGG + Intergenic
1001109432 5:168883584-168883606 CCTCTTGGCTCGTGGCCTGGAGG - Intronic
1003566976 6:7230265-7230287 TATCCTTGCGGGTGGCCTTGAGG - Exonic
1006154987 6:32009096-32009118 TCTCCTACCGAGGGGCCTGGTGG - Intergenic
1006161298 6:32041831-32041853 TCTCCTACCGAGGGGCCTGGTGG - Exonic
1020125087 7:5529169-5529191 TCTTCTCGCGGTTGGCCTTGGGG + Exonic
1020347754 7:7183127-7183149 TCTGCTCGCGCGCTGCCTGGCGG + Intronic
1023873423 7:44274710-44274732 TCTGCTGGCGGGTGGCCTGGAGG + Intronic
1026977769 7:74508809-74508831 TCTCCTAGCAGGTGACCTGGGGG + Intronic
1027266609 7:76498299-76498321 CCTCCTCGCCTGTGGGCTGGAGG - Intronic
1027317990 7:76996417-76996439 CCTCCTCGCCTGTGGGCTGGAGG - Intergenic
1028968260 7:96827350-96827372 TCTCCTCTGGAGTGACCTGGAGG - Intergenic
1029820414 7:103141390-103141412 TCTCCTCCTTCTTGGCCTGGAGG + Intronic
1035435643 7:158857020-158857042 TCTCCTCGCGCCCGGCCTGGAGG + Intronic
1037805274 8:22055236-22055258 TCTCCTGGGGTGGGGCCTGGTGG + Intronic
1045173548 8:99696647-99696669 TCTCCTCGATGGTGTCCTGGAGG - Intronic
1050561063 9:6834787-6834809 TCTTCTCGCGGCTGGCCTTGGGG - Intronic
1061441765 9:130609475-130609497 TCTCCTCCCCCGTGGCCAGGAGG + Intronic
1061514735 9:131082403-131082425 TCTCCTCTCACTTGGTCTGGAGG - Intronic
1061746910 9:132746768-132746790 TCGCCTCACGTGTGGCCCGGGGG - Intronic
1062086221 9:134650328-134650350 TCTGCTGGCGGGTGGCCTGGGGG + Intronic
1189796361 X:44649656-44649678 TCTCCTCCTTCTTGGCCTGGAGG - Intergenic
1199773875 X:150994028-150994050 TCTCCTCCTTCTTGGCCTGGAGG - Intergenic