ID: 1065390387

View in Genome Browser
Species Human (GRCh38)
Location 10:25175993-25176015
Sequence TCTCCTCGCGCGTGGCCTGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 84}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065390387_1065390394 22 Left 1065390387 10:25175993-25176015 CCTCCAGGCCACGCGCGAGGAGA 0: 1
1: 0
2: 1
3: 7
4: 84
Right 1065390394 10:25176038-25176060 GTCCTCCTCCGCACCCCACCTGG 0: 1
1: 1
2: 5
3: 20
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065390387 Original CRISPR TCTCCTCGCGCGTGGCCTGG AGG (reversed) Exonic