ID: 1065403304

View in Genome Browser
Species Human (GRCh38)
Location 10:25331699-25331721
Sequence TAACCTTGGAGTGCAGTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 158}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065403304_1065403309 15 Left 1065403304 10:25331699-25331721 CCAGTCACTGCACTCCAAGGTTA 0: 1
1: 0
2: 1
3: 14
4: 158
Right 1065403309 10:25331737-25331759 CATGCTTTGTTCTCTACATCAGG No data
1065403304_1065403310 16 Left 1065403304 10:25331699-25331721 CCAGTCACTGCACTCCAAGGTTA 0: 1
1: 0
2: 1
3: 14
4: 158
Right 1065403310 10:25331738-25331760 ATGCTTTGTTCTCTACATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065403304 Original CRISPR TAACCTTGGAGTGCAGTGAC TGG (reversed) Intronic
900369384 1:2324633-2324655 TCACCTGGGAGTGCCATGACTGG + Intronic
901557598 1:10044080-10044102 TCACGCTGGAGTGCAGTGGCAGG + Intronic
904049199 1:27628128-27628150 TCAGGCTGGAGTGCAGTGACAGG - Intronic
905501632 1:38444177-38444199 TAACCTTGCAATGATGTGACTGG - Intergenic
908514234 1:64875851-64875873 TACCCTTGAAGAGCAGTGCCAGG - Intronic
909553342 1:76924657-76924679 TATCCTTGGTGTACAATGACTGG + Intronic
910367680 1:86484194-86484216 TAACATTGCAGTGCACTTACTGG - Intronic
910596770 1:88989654-88989676 TAAGCTTGGAGTGCAGCTTCTGG + Intronic
912512614 1:110199181-110199203 TTGTCTGGGAGTGCAGTGACCGG + Exonic
921155563 1:212435589-212435611 TAAGCCTGGAGTGCAGTGGCAGG + Intronic
922459198 1:225801645-225801667 CCACCCTGGAGTGCAGTGGCAGG - Intergenic
923120345 1:230984204-230984226 TAGGCCTGGAGTGCAGTGGCAGG - Intronic
923183829 1:231550283-231550305 TTACTTTGGAGTGGAGGGACTGG + Intronic
923622723 1:235591327-235591349 TAACCTGGGAGTGAGGTGTCAGG + Intronic
924697370 1:246414447-246414469 TAACCTTGTAGAGAAGAGACAGG - Intronic
1063237973 10:4138472-4138494 TGACTTAGGTGTGCAGTGACTGG - Intergenic
1065403304 10:25331699-25331721 TAACCTTGGAGTGCAGTGACTGG - Intronic
1065927590 10:30449168-30449190 TACCCTTGGAGAGTAGCGACTGG + Intronic
1066573995 10:36805679-36805701 TAAGGCTGGAGTGCAGTGGCAGG + Intergenic
1069386414 10:67886510-67886532 CCACCCTGGAGTGCAGTGGCAGG - Intronic
1069590923 10:69641397-69641419 TTTCCTTGGAGTCAAGTGACAGG + Intergenic
1072608279 10:97001172-97001194 TCACCTTTGAGTGCAGCGATGGG - Exonic
1072705606 10:97678729-97678751 TCAGGCTGGAGTGCAGTGACAGG + Intronic
1075169751 10:120102178-120102200 TAACCTTGGAGAGCAGTTTTAGG + Intergenic
1076035083 10:127193409-127193431 TTACGTAGGAGGGCAGTGACAGG - Intronic
1079697276 11:23497698-23497720 CCAGGTTGGAGTGCAGTGACAGG + Intergenic
1080306072 11:30838060-30838082 CCACCCTGGAGTGCAGTGGCGGG + Intronic
1081032322 11:38099322-38099344 ATATATTGGAGTGCAGTGACAGG - Intergenic
1083421949 11:62558528-62558550 TAAGGCTGGAGTGCAGTGGCTGG - Intergenic
1084280248 11:68085265-68085287 TCAGGTTGGAGTGCAGTGGCAGG + Intronic
1084982770 11:72840381-72840403 TGACCTTGGAGTACAGTGGTGGG + Intronic
1085505444 11:77056205-77056227 GGCCCTTGGAGTGGAGTGACTGG + Intergenic
1085852808 11:80141350-80141372 TAAGCTCTGAGTGCAGTGTCTGG - Intergenic
1088611586 11:111582630-111582652 TCAGGCTGGAGTGCAGTGACTGG + Intergenic
1091072659 11:132583096-132583118 TCAGGCTGGAGTGCAGTGACAGG + Intronic
1096093819 12:48921149-48921171 TCACCTGGGAGTGGAGTTACAGG - Exonic
1098531365 12:71545406-71545428 TCACGCTGGAGTGCAGTGGCAGG - Intronic
1101312147 12:103590959-103590981 CAACCTTGGAGTCAAGTGCCCGG + Exonic
1103432769 12:120903241-120903263 GAACCTTGGAGGGGAGTCACTGG - Intronic
1104689455 12:130814397-130814419 TGACCTGGGAGTGGAGAGACTGG + Intronic
1105367488 13:19778196-19778218 CCACGTTGGAGTGCAGTGGCGGG - Intronic
1106661304 13:31802539-31802561 TGCCATTGGAATGCAGTGACAGG - Exonic
1108300232 13:49066835-49066857 TAAGCTTTGAGGGCAGTGAGGGG - Intronic
1109619450 13:64882224-64882246 AAACCTTGGAGTGGAATTACTGG + Intergenic
1111191226 13:84809885-84809907 TAAGATTTGAGTGCAGTGAGAGG + Intergenic
1111413148 13:87903150-87903172 TATTCTTGAAGTGCAGTGACTGG - Intergenic
1111949399 13:94698846-94698868 TCCCCTTGGAGTGCAGTGGCAGG + Intergenic
1112336401 13:98520687-98520709 TCACCTTGGAGAGCTGTGGCTGG - Intronic
1112462083 13:99611999-99612021 TAACATTGGACTGTAGTGATGGG - Intronic
1114854885 14:26426829-26426851 TAACTTTAGAGGGCAGTGTCAGG - Intergenic
1115844865 14:37518376-37518398 TTACTCTGGAGTGCAGTGGCGGG + Intronic
1119694587 14:76702642-76702664 TAACCTAGGAGTGGAGTTGCTGG - Intergenic
1119985713 14:79134946-79134968 TAACCTTGGTCAGCAGTGAAAGG - Intronic
1123753524 15:23378149-23378171 CCACGTTGGAGTGCAGTGATGGG - Intergenic
1124994401 15:34708826-34708848 TATCTGTGCAGTGCAGTGACAGG - Intergenic
1125113538 15:36062337-36062359 TAACCTAGCAGTGCACTGACTGG + Intergenic
1127998535 15:64170054-64170076 TAACCATGGAGCACAGTGGCTGG - Exonic
1128531918 15:68459139-68459161 TACCCCTGGAGGCCAGTGACTGG + Intergenic
1129371266 15:75097095-75097117 TGACCTTGGAGTGGAGAGAGGGG + Intronic
1133665094 16:7959305-7959327 TTACCTTGGATTCCAGTGGCAGG + Intergenic
1133999995 16:10775476-10775498 TGAGCTTGGAGCTCAGTGACTGG - Intronic
1136170327 16:28485526-28485548 TCAGGCTGGAGTGCAGTGACTGG - Intronic
1139944834 16:70633295-70633317 TCATGCTGGAGTGCAGTGACAGG + Intronic
1140035517 16:71368462-71368484 TCAGGTTGGAGTGCAGTGGCTGG - Intronic
1142521081 17:504978-505000 TGACCTTGGAGAGCAGGGTCAGG + Intergenic
1147571799 17:41576061-41576083 TCACCCTGGAGTGCAGTGGCTGG - Intergenic
1149448586 17:56732607-56732629 CATCCTTGGAGAGAAGTGACTGG - Intergenic
1149448606 17:56732704-56732726 CATCCTTGGAGAGAAGTGACTGG - Intergenic
1150042485 17:61878884-61878906 CAAGGTTGGAGTGCAGTGGCAGG - Intronic
1152518419 17:80839564-80839586 AAACCTTGGGGGGCAATGACAGG + Intronic
1155453248 18:25985023-25985045 TCACTCTGGAGTGCAGTGACAGG + Intergenic
1155828038 18:30473709-30473731 CCACCCTGGAGTGCAGTGGCGGG - Intergenic
1158202385 18:54955279-54955301 TGACGCTGGAGTGCAGTGTCAGG - Intronic
1159635594 18:70801003-70801025 TGAGGTTGGAGTGCAGTGGCGGG + Intergenic
1162054483 19:8054366-8054388 GAACCTCGGACTGCAGTGCCAGG - Intronic
1162448922 19:10742625-10742647 AAACCTTGGACTCCAGAGACAGG - Intronic
1162688389 19:12407417-12407439 TCAGGCTGGAGTGCAGTGACAGG - Intronic
1163004439 19:14388750-14388772 GAACCCTGGATTGCAGCGACAGG - Exonic
1163063023 19:14773984-14774006 GAACCCTGGATTGCAGCGACAGG + Exonic
925516791 2:4691980-4692002 TAACATTTGAGTCCAGGGACTGG + Intergenic
927943533 2:27120765-27120787 CAAGGTTGGAGTGCAGTGGCAGG - Intergenic
928119623 2:28574051-28574073 GAATCTTGGAATGCAGTGAAGGG - Intronic
929127478 2:38534928-38534950 TGAGCTTGGAGTGAAGTGACAGG + Intergenic
929971080 2:46577441-46577463 CCAGGTTGGAGTGCAGTGACGGG + Intronic
930233369 2:48865294-48865316 CAACTTTGGAGTGCAGTCAAAGG + Intergenic
930331380 2:49989462-49989484 TTTCCCTGGAGTGCATTGACCGG - Intronic
930928558 2:56851753-56851775 TGAAGTTGGAGTGCAGTGGCAGG + Intergenic
934145692 2:89091595-89091617 ATACCTAGGAGTGCAGTTACTGG + Intergenic
934223564 2:90108975-90108997 ATACCTAGGAGTGCAGTTACTGG - Intergenic
938033537 2:128016469-128016491 GAACCTTGGGGGGAAGTGACAGG + Exonic
940905520 2:159165934-159165956 TAACCATGTAGTACAGTGACAGG + Intronic
943475475 2:188349256-188349278 GAACCTTGGAGTGGAATTACTGG + Intronic
948748662 2:240114155-240114177 TAGTCTTGGAGGTCAGTGACTGG - Intergenic
1170462369 20:16589215-16589237 TCACCCTGGAGTGCAGTGACAGG - Intergenic
1174453458 20:50633683-50633705 TGACCTTGAAGTGGAGTGACTGG - Intronic
1174917866 20:54672144-54672166 CAAGCCTGGAGTGCAGTGGCAGG + Intergenic
1175384181 20:58583746-58583768 AACCCTTGGAGTGCTGTGTCTGG + Intergenic
1179069555 21:38058911-38058933 TGCTCCTGGAGTGCAGTGACAGG - Intronic
1184557776 22:45242314-45242336 CCAGCTTGGAGTGCAGTGGCGGG - Intergenic
1185318997 22:50191793-50191815 CCAGGTTGGAGTGCAGTGACAGG + Intronic
950497727 3:13344090-13344112 CAAGGCTGGAGTGCAGTGACGGG + Intronic
950628441 3:14265466-14265488 TAACCTCAGAGTGCAATGGCTGG - Intergenic
952826730 3:37530651-37530673 TTACCTTGAAGTGAAGTGACAGG + Intronic
953337196 3:42103541-42103563 TAACCTTGGAGAGCAGTGGTGGG + Intronic
954999405 3:54913126-54913148 TCAGACTGGAGTGCAGTGACTGG + Intronic
955352679 3:58205685-58205707 TAACCTTTGAGTCCAATGAGAGG + Intronic
956387326 3:68733975-68733997 TTACCTTCTAGTGCAGGGACTGG + Intronic
959534719 3:107471341-107471363 TGACCTTTGAGTGCAGTTTCTGG - Intergenic
960490278 3:118309018-118309040 TACCCTTGGAGTGAAGGGATAGG - Intergenic
962030761 3:131597983-131598005 TCCCCTTGCAGTGCAGAGACAGG - Intronic
962454792 3:135555053-135555075 TAAACTTGGAATGAAGGGACAGG + Intergenic
962576760 3:136762078-136762100 TAACTTTGGAGTGCAGTAAAGGG - Intergenic
963132374 3:141870338-141870360 TAACCCAGGAGTGCAATGTCGGG - Intergenic
967228772 3:187318224-187318246 TCAGGTTGGAGTGCAGTGCCGGG + Intergenic
968641926 4:1719222-1719244 TTACCTTGAAATGCAGTGACTGG - Intronic
971256665 4:25020468-25020490 TCACATTAGAGTGCAGTGCCTGG - Intronic
974487818 4:62526713-62526735 GAACCATGGAATCCAGTGACTGG + Intergenic
974858741 4:67493807-67493829 TAAACATGTAGTGCAGTGTCTGG + Intronic
976066339 4:81191955-81191977 AAACCTAGGAGTGAAGTTACTGG - Intronic
976829412 4:89297544-89297566 TTGCCTTGGAGCGCAGAGACTGG - Intronic
980976595 4:139616955-139616977 TCAGATTGGAGTGCAGTGGCAGG + Intergenic
981476265 4:145190260-145190282 TTACCTAGGAGTGTAATGACTGG + Intergenic
981673102 4:147310415-147310437 TAGACTTGGGGTGGAGTGACAGG - Intergenic
982227388 4:153178355-153178377 TAACCTTCAAGTACAGTAACTGG - Intronic
983223157 4:165062229-165062251 TCAGGCTGGAGTGCAGTGACAGG + Intergenic
984082035 4:175259703-175259725 TCAGGTTGGAGTGCAGTGGCAGG + Intergenic
985016500 4:185641326-185641348 TAACTTTGGAATGCAATGAAAGG + Intronic
986202172 5:5588626-5588648 TGACCTTGGTGAGCAGGGACTGG - Intergenic
987955665 5:24736857-24736879 TTACCTGGGAGTTCAATGACAGG - Intergenic
988655125 5:33202595-33202617 TAACCTGGGAGTGGAATTACTGG + Intergenic
989218128 5:38926285-38926307 TGACCCTGGAGTGCCCTGACTGG + Intronic
990605487 5:57405661-57405683 TAACATATGAGTGCAGTGCCAGG + Intergenic
990649516 5:57882357-57882379 TAATCATGGAGTGGAGTGAGAGG + Intergenic
992916853 5:81463810-81463832 CTAGGTTGGAGTGCAGTGACAGG + Intronic
995153214 5:108876814-108876836 TAACTTTGAACTGCAGTGATAGG + Intronic
996925321 5:128819384-128819406 TTACCTTGGAGTGGAATCACTGG - Intronic
998110744 5:139500702-139500724 TCAGGCTGGAGTGCAGTGACAGG + Intergenic
1001903096 5:175446961-175446983 TAACCTTGGAAAGCAGGAACGGG + Intergenic
1005609230 6:27507565-27507587 CAGGCTTGGAGTGCAGTGGCAGG + Intergenic
1005988489 6:30889198-30889220 TCAGGTTGGAGAGCAGTGACGGG + Exonic
1008063652 6:47025206-47025228 TACCCATGGTGTGCAGTGAATGG + Intronic
1008720116 6:54338678-54338700 TCGCCTGGGAGTGCAGTGGCGGG - Intronic
1008785559 6:55163191-55163213 TCAGGCTGGAGTGCAGTGACAGG - Intronic
1010953839 6:82068492-82068514 TCAGGTTGGAGTGCAGTGGCGGG - Intergenic
1015767829 6:136737761-136737783 TAACCTTCAAGTGCAATGGCTGG + Intronic
1017958773 6:159203770-159203792 TAACCTGGCAGTGCAGAGCCAGG + Intronic
1020236424 7:6359368-6359390 TCAGCCTGGAGTGCAGTGGCAGG + Intergenic
1020934405 7:14443248-14443270 TAACTTTGGAGAGAAGTGATGGG - Intronic
1026005173 7:66594696-66594718 TAACCTGGCAGTGCAGAGCCAGG + Intergenic
1031125893 7:117772915-117772937 TTACTTTGGACAGCAGTGACTGG - Intronic
1034170622 7:149060119-149060141 TGAGGCTGGAGTGCAGTGACTGG - Intergenic
1034854606 7:154530618-154530640 TAACCTTGCAGTCCAATTACTGG + Intronic
1036850418 8:12196792-12196814 TTATCTTGGTGTGCAGTGTCTGG + Intergenic
1036871784 8:12439065-12439087 TTATCTTGGTGTGCAGTGTCTGG + Intergenic
1037121132 8:15288276-15288298 GAACTTTGGAGGGCAGAGACGGG - Intergenic
1038145085 8:24887980-24888002 TAACCTTGAGGTGCAGTCAGAGG + Intergenic
1038780916 8:30567974-30567996 TACCCTTGGAGGGCAGAGATGGG + Intronic
1040287321 8:46107061-46107083 TAACCATGGAGTGGTGTGAGGGG - Intergenic
1042388822 8:68209021-68209043 TAAGGCTGGAGTGCAGTGGCAGG - Intronic
1042460164 8:69056441-69056463 CCAGGTTGGAGTGCAGTGACAGG + Intergenic
1048646121 8:136421729-136421751 TAAACCTGGAGTTCAGTGGCAGG + Intergenic
1049511582 8:143029634-143029656 TCACTTTGGAGTGCAGTGGCGGG + Intergenic
1049527108 8:143132819-143132841 TGACCTTGGTGTGCAAGGACTGG - Intergenic
1051390464 9:16557902-16557924 CCACGTTGGAGTGCAGTGGCAGG + Intronic
1053439593 9:38105304-38105326 TCACCCAGGAGTGCAGTGGCGGG + Intergenic
1053600989 9:39609354-39609376 TAACCTTGGAATGTGGGGACAGG - Intergenic
1054252546 9:62733084-62733106 TAACCTTGGAATGTGGGGACAGG + Intergenic
1054566661 9:66767583-66767605 TAACCTTGGAATGTGGGGACAGG + Intergenic
1060434287 9:123580511-123580533 AAACCATGGAGTGGACTGACTGG - Intronic
1061930399 9:133829676-133829698 TCAGGCTGGAGTGCAGTGACAGG + Intronic
1190201406 X:48364644-48364666 TGAGGTTGGAGTGCAGTGGCAGG - Intergenic
1197626499 X:128808036-128808058 AAACCTAGGAGTTGAGTGACAGG + Intergenic
1199508740 X:148595965-148595987 TAATCTAGGGGTGCAGTGGCAGG + Intronic
1199641685 X:149868462-149868484 GAACCTGGGAGTCCAGGGACAGG + Intergenic