ID: 1065403378

View in Genome Browser
Species Human (GRCh38)
Location 10:25332572-25332594
Sequence CTGTATTTGCAGAGGCATTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065403374_1065403378 -5 Left 1065403374 10:25332554-25332576 CCTGTAAGGAGCCTGGTACTGTA 0: 1
1: 0
2: 1
3: 9
4: 115
Right 1065403378 10:25332572-25332594 CTGTATTTGCAGAGGCATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065403378 Original CRISPR CTGTATTTGCAGAGGCATTT GGG Intronic
No off target data available for this crispr