ID: 1065413371

View in Genome Browser
Species Human (GRCh38)
Location 10:25456152-25456174
Sequence TGCCCCCTATTTGCAAGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 85}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065413371 Original CRISPR TGCCCCCTATTTGCAAGAAG AGG (reversed) Intronic
900871288 1:5305449-5305471 TGCCCACTGTTCCCAAGAAGGGG + Intergenic
905477101 1:38236682-38236704 TTCCCCCTCTGTGCTAGAAGAGG - Intergenic
905789131 1:40781175-40781197 TTCCCCATCTGTGCAAGAAGTGG - Intergenic
907662414 1:56405437-56405459 TGCCACATATTAGCAAGTAGAGG + Intergenic
908716706 1:67078482-67078504 TGCCCACTAGTTCCAAGAATAGG - Intergenic
910739938 1:90504161-90504183 TGCCCCAAATTTGAGAGAAGGGG - Intergenic
910921418 1:92351773-92351795 TGCAGCCTATGTGCCAGAAGTGG + Intronic
916693048 1:167209506-167209528 TCCCCTCTATTTGAAAGCAGTGG + Intergenic
917756797 1:178109612-178109634 TGCAACCTATTTGTAAGAAATGG - Intronic
922061429 1:222096345-222096367 TGCCCCCTAGAGGCAAGGAGGGG - Intergenic
923851242 1:237797493-237797515 TGCCCCCTATTGGCATGCAGAGG + Intronic
924607448 1:245547205-245547227 TTCCCACTCTTTGCAAGAACGGG - Intronic
1065413371 10:25456152-25456174 TGCCCCCTATTTGCAAGAAGAGG - Intronic
1066261508 10:33733711-33733733 TGCACACAATTTGCAAGTAGAGG - Intergenic
1072921138 10:99578300-99578322 TACGCCCTATGTGCATGAAGAGG - Intergenic
1073098235 10:100993410-100993432 AGCCCCCTTTTTGCCAGAAGAGG - Exonic
1076235594 10:128861588-128861610 TTCCACCTCTTTGCAACAAGTGG - Intergenic
1081888775 11:46522565-46522587 TGCCCCCTACATGCAACAGGTGG + Intronic
1083261543 11:61525721-61525743 TGCCTACTATGTGCCAGAAGCGG - Intronic
1095480610 12:42631131-42631153 TGCCTCGTATGTGCAAGGAGCGG + Intergenic
1096872661 12:54603769-54603791 AGCCCCCACTTTGAAAGAAGAGG + Intergenic
1097068554 12:56338369-56338391 TGCCCCCTATTAGGAATAAACGG - Intronic
1102454154 12:113061187-113061209 TGCCCCCTGTTTGCCGGAAAAGG + Intronic
1112881528 13:104111942-104111964 TGGCCCCTCATTGCTAGAAGAGG + Intergenic
1114257697 14:21017214-21017236 TGTCCCATATTTGCAAGGGGAGG - Exonic
1115498675 14:34030369-34030391 TGCCTCCTTTTTTCAAGGAGAGG - Intronic
1116254169 14:42528652-42528674 TTGCCCCTATTTGCAAAGAGGGG - Intergenic
1118694331 14:68369612-68369634 TGGCACCTATTTGAAAGAACAGG - Intronic
1119752840 14:77092561-77092583 AACCCCCTCTTTGCTAGAAGGGG - Intergenic
1124126120 15:26939346-26939368 TGCCCCCGATTTCAAAGAACAGG + Intronic
1124886947 15:33696129-33696151 TGTCTTCTATTTGCATGAAGTGG + Intronic
1128791144 15:70434789-70434811 TGTCTCCTATCTGGAAGAAGAGG - Intergenic
1130799062 15:87242620-87242642 TGCCACTTATTTGGAAGATGAGG + Intergenic
1131190894 15:90315778-90315800 TTCCTCCTCTTGGCAAGAAGGGG - Intergenic
1131893929 15:97005214-97005236 GGCCACCTATGGGCAAGAAGAGG + Intergenic
1140380645 16:74484082-74484104 TGCCCCCTCTTTGCTTGATGTGG + Intronic
1141897925 16:86970532-86970554 TGCCACCTACTTCCAAGAAAGGG + Intergenic
1144404143 17:14936191-14936213 TGGCCCCGATATGCAAGAAGTGG - Intergenic
1156245606 18:35295000-35295022 TGCCCTCTTTTTGATAGAAGTGG + Intergenic
1158071731 18:53478244-53478266 TGCAGGCTATTTCCAAGAAGTGG + Intronic
1161906362 19:7159781-7159803 TGCCTCCTTTTTGGGAGAAGGGG - Intronic
1164738449 19:30559580-30559602 TGCCCCAGGTTTGCAGGAAGTGG - Intronic
925566809 2:5263877-5263899 TGAATCCTATTTGCAAGAATGGG - Intergenic
926071424 2:9896221-9896243 TTCCCTCTTTTTTCAAGAAGAGG + Intronic
929008097 2:37415045-37415067 TACCCTCATTTTGCAAGAAGAGG + Intergenic
929445374 2:41997055-41997077 TGTCCCCTGTTTGGAGGAAGGGG - Intergenic
933978703 2:87532854-87532876 AGCCCCCAACTTGCAACAAGTGG - Intergenic
936315129 2:111417941-111417963 AGCCCCCAACTTGCAACAAGTGG + Intergenic
1173332700 20:42088297-42088319 AGCCCCCTATTTGCAAGCCTGGG - Intronic
1174987162 20:55467945-55467967 TGCCTCTTATTTGCAAGACATGG + Intergenic
1175474831 20:59264843-59264865 GGCCACCCATTTGCAAGGAGAGG + Intergenic
1179421424 21:41239680-41239702 TTCCCCCCATTTTCAAGATGTGG + Intronic
1180724700 22:17937983-17938005 TGCCTCCTCCTTGCAAGAAAGGG - Intronic
949439852 3:4068709-4068731 TGATCCCTATTTTCAAGATGTGG - Intronic
950158311 3:10740408-10740430 TGCCCACTATGTGCCAGACGTGG + Intergenic
953350304 3:42210308-42210330 TGCCTCCTATTTGTAACAATGGG + Intronic
954189995 3:48952699-48952721 TGCCCCCCACTGGCAAGATGGGG + Intronic
956488317 3:69744476-69744498 AGGCCCCTATTTGCCAGATGAGG - Intronic
959850323 3:111078316-111078338 TGCTCACTGTATGCAAGAAGTGG - Intronic
959918658 3:111847047-111847069 TGCTCCCTCCTTGCAGGAAGAGG + Intronic
962405473 3:135096248-135096270 AGCCCCCCATTTGTAAAAAGGGG - Intronic
966203566 3:177382653-177382675 TGCCCCTTACTTCCAAGATGAGG - Intergenic
969533337 4:7741268-7741290 TGACCCTCATTTTCAAGAAGGGG + Exonic
974001124 4:56511710-56511732 TGCCATCTATTTAGAAGAAGAGG - Intronic
975378803 4:73674721-73674743 GGCCCCATATTTCCAAGGAGTGG + Intergenic
977774093 4:100896811-100896833 TTCCCCCTATTTCCAAGTAGTGG - Intergenic
984404347 4:179307735-179307757 TGCCACCTAGTGGCAAAAAGAGG + Intergenic
986603567 5:9498654-9498676 TGCCGCCGATTTGCAATATGAGG - Intronic
993313367 5:86367085-86367107 TTTTCCCTATTTGCAAGATGAGG - Intergenic
994336795 5:98576549-98576571 TGACCCCTACTTGCAGGATGTGG + Intergenic
994906058 5:105841909-105841931 TACACCTTCTTTGCAAGAAGTGG + Intergenic
997465290 5:134084009-134084031 TGCCCCCTATTTTACAGATGAGG - Intergenic
998389982 5:141780986-141781008 TGCCTGTTATTTGGAAGAAGGGG - Intergenic
1007368841 6:41413164-41413186 TGCCCCTTTTTTTCAAGAAAAGG + Intergenic
1007701450 6:43768776-43768798 TGCTTCCTATATGCAAGAATGGG + Intergenic
1008222812 6:48875693-48875715 TACCGCCTGTTTGCAAGACGCGG + Intergenic
1012966517 6:105680342-105680364 AGCCCCATACTTGCAATAAGGGG + Intergenic
1014515404 6:122371922-122371944 TGCCTTATATTTGCAAAAAGAGG + Intergenic
1017913542 6:158815395-158815417 TGCCCCCTCTTTGGCAGAGGAGG - Intronic
1021430782 7:20556533-20556555 AGCTCCCTATTTCCAAGCAGAGG + Intergenic
1022270172 7:28799340-28799362 TGCCCACTATTTGAAGGAAGTGG - Intronic
1032387073 7:131532551-131532573 TACCCCCTATTTTCCAGATGGGG - Intronic
1034435472 7:151060985-151061007 CGCCCCCTATTTGCAGGGATTGG + Intronic
1035456123 7:159010080-159010102 TGCCCCCCATTTGCGAGAGTGGG + Intergenic
1048088011 8:131205174-131205196 GGCTTCCTATTTGCAAGGAGAGG - Intergenic
1050289657 9:4140550-4140572 TCACCCCTATTTCCAAGAAATGG + Intronic
1059190449 9:112321171-112321193 TAAACCCTATTTGAAAGAAGGGG + Intronic
1059383830 9:113948959-113948981 TTCCCCCTTTTGGGAAGAAGCGG - Intronic
1187378435 X:18778555-18778577 TTCCCCCAATTTGCAAAATGGGG - Intronic
1197098761 X:122626503-122626525 TACCCCATATTTGAAAGAAATGG + Intergenic
1198678284 X:139154200-139154222 TGACCACTATTAGCAAGATGAGG + Intronic