ID: 1065415440

View in Genome Browser
Species Human (GRCh38)
Location 10:25480455-25480477
Sequence ATGAATACAGAGTTTTAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 895
Summary {0: 1, 1: 2, 2: 23, 3: 144, 4: 725}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065415440 Original CRISPR ATGAATACAGAGTTTTAGCT TGG (reversed) Intronic
900854436 1:5169703-5169725 AGGAATACAGACTCTTAGCTAGG + Intergenic
901150474 1:7097880-7097902 ATGGGTACAGCGTTTCAGCTGGG + Intronic
901162365 1:7188432-7188454 ATGGGTACAGAGTTTCAGTTTGG - Intronic
902567143 1:17319244-17319266 AAGAGTACAGGGTTTTACCTAGG + Intronic
903103762 1:21055249-21055271 ATGAATACACATTTTTAACACGG + Intronic
903468973 1:23572007-23572029 ATGGATACAGGGTTTTATGTGGG + Intergenic
903820587 1:26099549-26099571 ATGGATACAGAGTTGCAGTTTGG + Intergenic
904078163 1:27855362-27855384 CTGAATCCAGAGTTTAAGGTGGG + Intergenic
904173636 1:28609860-28609882 ATGGATATAGAGTTTCAGTTTGG - Intronic
904323764 1:29713753-29713775 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
904513152 1:31031126-31031148 ATGAAGACAGGATGTTAGCTAGG + Intronic
905160738 1:36031648-36031670 ATGGATAAAGAGTTTCAGTTTGG - Intronic
905577791 1:39059608-39059630 ATGAATACAGAGATCTAGGCTGG + Intergenic
905671972 1:39797506-39797528 ATGGATACACAGTTTCAGTTTGG + Intergenic
906368519 1:45232293-45232315 ATAAATACAAAGTATTAGTTTGG - Intronic
906724179 1:48031779-48031801 ATGGATACAGAGTTTCTGTTTGG + Intergenic
907131182 1:52098529-52098551 GTGAGTACAGAGTTTGAGTTTGG + Intergenic
907177873 1:52542217-52542239 ACGGGTACAGAGTTTCAGCTTGG + Intronic
907538365 1:55186791-55186813 ATGGGTACAGAGTTTCAGCTGGG + Intronic
907653297 1:56317225-56317247 ATGGATACAAAGTTTCAGTTTGG + Intergenic
907797398 1:57731344-57731366 ATGAGTACAGAGTATCAGTTAGG + Intronic
908222991 1:62027087-62027109 ATGTATACAGAGATTCAGTTTGG - Intronic
908263615 1:62358013-62358035 AAAAACACAGATTTTTAGCTGGG + Intergenic
909135146 1:71789151-71789173 ATGAATACAGAGTCTGTGATAGG - Intronic
909548596 1:76874364-76874386 ATGAATTATGAGATTTAGCTTGG - Intronic
909635203 1:77810077-77810099 ATAATTACAAAGTTTTAGATGGG - Intronic
909736024 1:78962560-78962582 ATCAATATAAAGTTTCAGCTTGG - Intronic
910316439 1:85889867-85889889 ATGGGTACAGAGTTTCAGTTTGG - Intronic
910340304 1:86179620-86179642 ATGGGTACAGAATTTTAGTTTGG - Intergenic
910467112 1:87511676-87511698 ATGGTTACAGAGTTTTTGTTTGG - Intergenic
910746750 1:90582679-90582701 ATGGATACAGAATTATACCTAGG - Intergenic
910938420 1:92506246-92506268 ATGAATACAGAACTTTTGTTTGG - Intergenic
911018855 1:93366049-93366071 ATGAATACATAATTTCAGTTTGG - Exonic
911130625 1:94383804-94383826 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
911345193 1:96688449-96688471 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
911393881 1:97280775-97280797 ATGAATACAAAGTTATAGTTAGG + Intronic
911461374 1:98195430-98195452 ATGTCCACAGAGTTTTGGCTTGG + Intergenic
911475923 1:98372288-98372310 ATGAATACATAATTTTAAATAGG - Intergenic
911553456 1:99312982-99313004 ATGCACACACAATTTTAGCTGGG - Intergenic
911815079 1:102339272-102339294 ATGGATACAGAGTCTCAGCTTGG - Intergenic
912548651 1:110469488-110469510 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
912673997 1:111660170-111660192 CTTAATACAGAGTTGTAACTTGG + Intronic
913040101 1:115013686-115013708 ATGAGTACAGAGTTTTCTTTTGG - Intergenic
913137977 1:115911177-115911199 AAGGATACAGAATTTTACCTGGG + Intergenic
913414799 1:118593087-118593109 ATGAGTACAGAGTTTTACTCCGG + Intergenic
914426190 1:147579159-147579181 ATGAAAACCAAGTTTCAGCTGGG - Intronic
914723498 1:150308501-150308523 ATGGGTACAGAGTTTCAGTTTGG + Exonic
914973916 1:152340014-152340036 ATGGATACAGAGTTTCAGCTTGG + Intergenic
916291248 1:163168767-163168789 ATGCATGCAGAGTTCTACCTGGG - Intronic
916500821 1:165385246-165385268 ATGATTACAGAGTTTCTGTTTGG - Intergenic
916504789 1:165418636-165418658 ATAAATACAGGATTTTATCTTGG + Intronic
916617729 1:166459942-166459964 ATGAGTACAAAATTTCAGCTAGG - Intergenic
916643456 1:166757506-166757528 ATCCGTACAGAGTTTTAGTTGGG - Intergenic
916769276 1:167892317-167892339 ATGTATTCTGAGTTTTGGCTTGG + Intronic
917950625 1:180029582-180029604 ATGAATACAGAGCTTCAGTACGG - Intronic
917985796 1:180317374-180317396 ATGGGTACAGAGTTTCAGTTTGG + Intronic
918190305 1:182167524-182167546 ATGAATATGGAGTTTCAGTTTGG + Intergenic
918394914 1:184103725-184103747 ATGGATACAGAGTTTAATTTTGG - Intergenic
918652385 1:186981687-186981709 ATGGTTACAGAGTTTTAGTTTGG - Intronic
918754474 1:188320547-188320569 ATGAATTCAGAATTTTAGAAAGG - Intergenic
919202128 1:194368738-194368760 ATAAATACAGGGTTTTATTTTGG - Intergenic
919697273 1:200590658-200590680 ACAAATACAGAGTTTCAGTTTGG + Intronic
919831472 1:201543787-201543809 ATGAGTACAGAGTTTAAGTTTGG - Intergenic
920121549 1:203662426-203662448 ATGGGTACAGAGTTTCAGTTTGG - Intronic
920627261 1:207614252-207614274 ATGAACTAAGACTTTTAGCTGGG + Intronic
920656124 1:207876475-207876497 ATTAAAACAGAGTTAGAGCTAGG + Intergenic
920733138 1:208507302-208507324 AAGAATACAGAATTACAGCTAGG + Intergenic
920808257 1:209255493-209255515 ATGGGTACAGAGTTTCAGCTTGG - Intergenic
921622444 1:217340736-217340758 TGGAGTACAGAGTTTAAGCTGGG - Intergenic
922121055 1:222669107-222669129 ATAATTACAAAGTTTTAGATGGG - Exonic
922209024 1:223472935-223472957 ATGGATACAGAGTTTCTGTTAGG - Intergenic
922650990 1:227338049-227338071 AAGAATACAGAAAATTAGCTGGG + Intergenic
922985412 1:229862532-229862554 AGGAGTACAGAGTTTCAGTTTGG - Intergenic
922996766 1:229970463-229970485 ATGGATACAGGGTTTCAGTTTGG + Intergenic
923069223 1:230547594-230547616 ATGGAGACAGAGTTTCAGTTTGG - Intergenic
923549802 1:234954551-234954573 GAAAATCCAGAGTTTTAGCTCGG - Intergenic
924280229 1:242429890-242429912 ATGAATTCTGAGTTTTCCCTAGG - Intronic
924545493 1:245022864-245022886 ATGGGTACAGAGTTTCAGTTTGG - Intronic
924714103 1:246556314-246556336 ATGAGTACAGAGTTTTGGTATGG + Intronic
1063576699 10:7267907-7267929 AGGAATACAGAAATATAGCTGGG - Intronic
1065415440 10:25480455-25480477 ATGAATACAGAGTTTTAGCTTGG - Intronic
1065459424 10:25941729-25941751 TTGAATCCAGAGTTTCAGTTTGG - Intronic
1065518310 10:26546636-26546658 ATGAGTACAGTGTTATAGTTAGG - Intronic
1065661136 10:28005207-28005229 ATAAGTACAGAGTTTCAGTTTGG + Intergenic
1066050383 10:31629661-31629683 ATGAATACAGAGCTTCTGTTTGG - Intergenic
1066110561 10:32192585-32192607 ATGGGTACAGAGTTTTAGTTTGG - Intergenic
1066252999 10:33652336-33652358 ATGAGTACAGAGTTTCAGCTTGG - Intergenic
1066268755 10:33801446-33801468 AAGAATACAGAAAATTAGCTGGG + Intergenic
1066524132 10:36257743-36257765 AGGAATGCAGAATTTAAGCTGGG + Intergenic
1066611714 10:37255599-37255621 ATGACTACAGAGTTTCAGTTTGG - Intronic
1066785589 10:39000590-39000612 ATGAAAAGAAAGTTTTAACTTGG + Intergenic
1067237571 10:44464189-44464211 ATGGAGACAGAGTTTCTGCTGGG - Intergenic
1067312057 10:45123497-45123519 ATGAATAAAGAGCTTTAATTGGG + Intergenic
1067407408 10:46035675-46035697 ATGGATATAGAGTTTCAGATTGG + Intronic
1067536263 10:47112479-47112501 ATGAAGGCAGTGTTTTAGCAGGG + Intergenic
1067856867 10:49801929-49801951 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
1068629709 10:59286627-59286649 ATGGGTACAGAGTTTTATATTGG + Intronic
1068875426 10:61990872-61990894 ATGCATACAAAGTTTTTGTTAGG - Intronic
1069244473 10:66186014-66186036 ATGGATACAAAGTTATAGTTAGG + Intronic
1069535919 10:69253063-69253085 ATGAATAAAGATTTTTAATTGGG + Intronic
1070051006 10:72889791-72889813 ATGCATACAGAGTGTCAGTTTGG + Intergenic
1070062627 10:72999614-72999636 ATGAGTACAGAGTTTCAGTTGGG - Intergenic
1070193569 10:74134525-74134547 GAGAATACAGAGTTATAACTAGG + Intronic
1070368732 10:75761559-75761581 ATGGATACAGAGTTTCTGTTTGG + Intronic
1070441917 10:76454973-76454995 ATGAGTACAGAGTTTTAGTTTGG + Intronic
1071499367 10:86192560-86192582 ATGAGTACAGAGTTTCGGTTTGG + Intronic
1072079941 10:92019207-92019229 ATGAATATAGAGTTTCTGTTTGG - Intronic
1072136501 10:92551730-92551752 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1072154280 10:92709802-92709824 ATGGATACAGAGTTTTATTTTGG - Intergenic
1072497632 10:95977945-95977967 ATGTGTACAGAGTTTCAGTTTGG + Intronic
1072919302 10:99562366-99562388 AACAGTACAGAGTTTTAGTTTGG + Intergenic
1073230470 10:101965041-101965063 ATGAGTACTGAGTTTCAGTTTGG + Intronic
1073271354 10:102266941-102266963 GTGAATTCAGAGTCTGAGCTAGG + Intronic
1073564984 10:104527306-104527328 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1073739180 10:106386633-106386655 ATGATTACAGAATTCCAGCTGGG + Intergenic
1073992765 10:109282242-109282264 AAGAGTAGAGAGTTTTAGCCCGG - Intergenic
1074736431 10:116439052-116439074 ATGGGTACAGAATTTTAGTTTGG + Intronic
1075525381 10:123180653-123180675 ATGAGTACAGAATTTCAGTTTGG + Intergenic
1075535352 10:123266947-123266969 ATGGGTACAGAGTTTCAGTTGGG - Intergenic
1076064025 10:127434537-127434559 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1076392838 10:130116506-130116528 GTGAGTACAGAGCTTTCGCTTGG + Intergenic
1077790881 11:5438544-5438566 CTGAGTGCAGAGTTTTAGCTTGG + Intronic
1078061507 11:8048560-8048582 AAGAAAACAAAGATTTAGCTGGG - Intronic
1079088841 11:17466535-17466557 ATGAGTACAGAGTTTCAACCTGG + Intronic
1079368275 11:19828313-19828335 ATGGGTACAGAGTTTTGGTTTGG - Intronic
1079904386 11:26226903-26226925 ATGAGTACTGAGTTTCAGTTTGG - Intergenic
1080375288 11:31702409-31702431 ATGGATACAGAGTTTCAATTTGG + Intronic
1080376682 11:31721503-31721525 TTGAATACACAGTTTTAGAAAGG - Intronic
1080490128 11:32753453-32753475 AAGAAAACAAAATTTTAGCTGGG - Intronic
1080960082 11:37147817-37147839 ATGGCTACAGAGTTTCAGTTTGG - Intergenic
1081225986 11:40522667-40522689 ATGAGTTCAGAGTTTCAGTTAGG - Intronic
1081255804 11:40892806-40892828 ATGAGTACAGAGTTTTTGTTGGG + Intronic
1081432663 11:42993500-42993522 AAGAATACAAAGAATTAGCTGGG - Intergenic
1082892003 11:58149583-58149605 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1083065255 11:59917070-59917092 CTGAATGCAGAGTTTTGGCATGG - Intergenic
1084281539 11:68098527-68098549 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1084874634 11:72121892-72121914 TTAATTACAGAGTTTCAGCTGGG - Intronic
1085151989 11:74259565-74259587 ATGGGTACAGAGTTCTTGCTGGG - Intronic
1085242343 11:75068520-75068542 ATAAATACAGAGTTTCTGTTTGG - Intergenic
1085801273 11:79592010-79592032 ATGGGTACAGAGTTTTTGTTTGG - Intergenic
1085802664 11:79604788-79604810 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1086130059 11:83392255-83392277 ATGGATAGAGAGTTTCAGTTTGG - Intergenic
1086338031 11:85818849-85818871 ATAAATACAAAATATTAGCTGGG - Intergenic
1086380616 11:86248721-86248743 ATGAAAAAAGAGTTGTGGCTGGG + Intronic
1086944546 11:92832033-92832055 TAGAATACAGAGCTTCAGCTTGG + Intronic
1087334452 11:96825906-96825928 ATGGAGACAGAATTTTAGTTTGG + Intergenic
1087646836 11:100817934-100817956 ATGTTATCAGAGTTTTAGCTTGG + Intronic
1088215880 11:107508626-107508648 ATTGATACAGAGTTTCAGTTTGG - Intronic
1088530697 11:110806075-110806097 ATGAAGCCAGAGGTCTAGCTTGG + Intergenic
1088642514 11:111887072-111887094 ATAGGTACAGAGTTTTAGTTCGG - Intergenic
1088791995 11:113234407-113234429 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1089799541 11:121013907-121013929 ATGGGTACAGAGTTTTTGTTTGG + Intergenic
1090285925 11:125499137-125499159 ATGGATACAGAGTTTCTGTTTGG - Exonic
1090743560 11:129689319-129689341 ATGAGTACAGAGTTTCTGTTTGG + Intergenic
1091081704 11:132675571-132675593 ATGAATAAAGAAATTTAGCAAGG + Intronic
1091164550 11:133463274-133463296 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1091502671 12:1033923-1033945 ATAAAAACAGAATTTAAGCTGGG - Intronic
1091608646 12:1982337-1982359 ATGGGTACAGAGTTTTAGTTTGG - Intronic
1091664348 12:2408267-2408289 TTAAATACAGAGTTTCAGTTTGG + Intronic
1091983819 12:4890771-4890793 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1092149837 12:6240211-6240233 ATGAGTACAGAGTTTCTGTTTGG + Intergenic
1092207522 12:6624398-6624420 ATGACTGCAGAGTTGTTGCTTGG - Intronic
1092466053 12:8732875-8732897 AAGAATAAAGAATTTTGGCTGGG - Intronic
1092832016 12:12453371-12453393 ATGAACACAGCTTTTTACCTTGG + Intronic
1093326223 12:17778141-17778163 ATGAATTCAGTGATTTTGCTGGG + Intergenic
1093359377 12:18203953-18203975 ATAAATACAGAAAATTAGCTGGG + Intronic
1093688283 12:22081431-22081453 TTTAATACAGAGTATTGGCTGGG - Intronic
1094267145 12:28572223-28572245 ATAAGTACTGAGTTTTAACTGGG + Intronic
1094311210 12:29086131-29086153 ATGGATACAAAGTTTTGGTTTGG + Intergenic
1094462790 12:30715538-30715560 ATGATTACAAAGTTTCAGTTGGG + Intronic
1094666177 12:32523412-32523434 ATGAGTACAGAGTTTCAGTTGGG - Intronic
1094776590 12:33736506-33736528 ATGAGTATAGAGTTTCAGTTTGG - Intergenic
1095077025 12:37943292-37943314 ATGAAAAGAAAGTTTTAACTTGG + Intergenic
1095394750 12:41749210-41749232 ATGACTACAAAGTTACAGCTAGG - Intergenic
1095577095 12:43752753-43752775 ATAAATATGGAGTTTTAGTTTGG + Intronic
1096014669 12:48258775-48258797 ATGGGTACAGAGTTTCAGTTGGG + Intergenic
1096042688 12:48531841-48531863 AAGAATACACAGTTTTCCCTGGG + Intergenic
1096166974 12:49434408-49434430 ATGGATACAAAGTTTTTGTTGGG - Intronic
1096394289 12:51254042-51254064 ATGAGTATAGAGTTTTAGTTTGG + Intronic
1096430178 12:51536835-51536857 AAAATTGCAGAGTTTTAGCTAGG + Intergenic
1096736937 12:53662977-53662999 ATAAAGACAAAGTTTTGGCTGGG + Intronic
1096752859 12:53773603-53773625 ATGGGCACAGAGTTTTAGTTGGG + Intergenic
1097002309 12:55887572-55887594 ATGGATATAGAGTTTTTGTTTGG - Intergenic
1097158757 12:57030780-57030802 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1097234584 12:57530506-57530528 ATGAATACAGAGTGGTAGCTAGG - Exonic
1097610467 12:61813624-61813646 AAGAATATATAGTTTTAGCTTGG - Intronic
1097774090 12:63625783-63625805 ATGTATACAAAGTTTCAGTTAGG + Intronic
1097781525 12:63711738-63711760 ATGGATACAGAGTTTCTGTTTGG + Intergenic
1097810019 12:64008557-64008579 ATAAATATAGAGATTTTGCTTGG + Intronic
1098238047 12:68437609-68437631 ATGAGCACAGAGTTTCAGTTGGG + Intergenic
1098397619 12:70038289-70038311 TTGAATATAGAATTCTAGCTTGG - Intergenic
1098586250 12:72157247-72157269 ATGAAGACAGAGAGGTAGCTAGG + Intronic
1098787522 12:74778952-74778974 TTGAATAAAGAGTCTCAGCTAGG - Intergenic
1099551481 12:84050070-84050092 AAGGATACACAGTTTTAGTTAGG - Intergenic
1099896908 12:88659705-88659727 ATTAAAATAGAGTTTTGGCTGGG - Intergenic
1099964044 12:89426260-89426282 ATGAGTACAGAGTTTCTACTTGG + Intronic
1099986233 12:89667976-89667998 ATGAACACAAAGTGTTAGCCAGG + Intronic
1100167029 12:91927869-91927891 ATGAATACAGAATATTAGTTTGG + Intergenic
1100270944 12:93023961-93023983 ATGAGTGCAGAGTTTTAGTCTGG - Intergenic
1100625708 12:96329165-96329187 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1101208916 12:102516629-102516651 ATGAATTCAGAGTTTTAGCTTGG + Intergenic
1101380521 12:104210421-104210443 ATGGGTACAGAGTTTTAATTTGG - Intergenic
1102138895 12:110598231-110598253 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1102787783 12:115618519-115618541 ATGGATACAGAGTTTCAATTTGG + Intergenic
1103030901 12:117611991-117612013 ATGAGTACAGAGTTTCAGTTGGG + Intronic
1103040963 12:117695251-117695273 ATGGGTACAGAGCTTTAGTTTGG + Intronic
1103424620 12:120822120-120822142 ATGCATACAGAGTTTCTGTTTGG + Intronic
1103589174 12:121979005-121979027 ATGAACACTGAGTCTTAGCTGGG - Intronic
1103733993 12:123047134-123047156 ATCAATACATAGCTTTAGCCTGG - Intronic
1103734205 12:123048728-123048750 ATGAGGACAGAGTTTTAGTTTGG + Intronic
1103962804 12:124619870-124619892 ATGGAGACAGAGTTTCAGTTTGG + Intergenic
1104090583 12:125513480-125513502 ATGAGAACAGAATTTTAACTGGG + Intronic
1104648697 12:130515334-130515356 ATGAAGACAGAGTTTCAGTTGGG - Intronic
1105204549 13:18209629-18209651 CAGAATACAGAATTTTAGGTTGG - Intergenic
1105226501 13:18439473-18439495 ATGAGTACAGAGTTTCAGTTTGG - Intergenic
1105748297 13:23398235-23398257 AGAAATACATGGTTTTAGCTGGG + Intronic
1105776576 13:23667687-23667709 ATGGAGACAGAGTTTCAGTTTGG - Intronic
1105822853 13:24095443-24095465 ACGGGTACAGAGTTTTAGTTAGG + Intronic
1105909487 13:24848737-24848759 ATGAATATAGAATTTCAGTTAGG - Intronic
1106010451 13:25816037-25816059 ATTAATACAGAATTTCAGTTTGG + Intronic
1106014593 13:25856709-25856731 ATGAGCACAGAGTTTCAGTTTGG - Intronic
1106216225 13:27702898-27702920 CTGAATACAGAATTCTAGGTTGG + Intergenic
1106441327 13:29775271-29775293 AAGAATAAAGAGTTTTAACTGGG + Intronic
1106520653 13:30494757-30494779 ATGGATACAGAGTTTTAATTGGG - Intronic
1106567007 13:30894777-30894799 AATAATACACAGTTTTGGCTAGG + Intergenic
1106772426 13:32974755-32974777 ATGAGTACAGAGTTTTGGTTTGG - Intergenic
1107271734 13:38626978-38627000 ATGACTCCTGAGTTTTAGCTGGG - Intergenic
1107598857 13:41992091-41992113 ATGGATACAGAGTTTCTGCCTGG - Intergenic
1107611426 13:42117503-42117525 ATGATTAAAAAGATTTAGCTGGG - Intronic
1108200610 13:48039305-48039327 ATGAATACAGAGGTAGAGCAAGG - Intronic
1108560919 13:51643204-51643226 ATGGATACAGAATTTCCGCTTGG - Intronic
1109290566 13:60470003-60470025 ATGGGTACAGAGTTTAAGTTTGG - Intronic
1109858143 13:68160668-68160690 TTGAAAACAGCTTTTTAGCTGGG + Intergenic
1110992165 13:82055899-82055921 ATGGGTACAGAATTTCAGCTGGG + Intergenic
1112022422 13:95383283-95383305 ATGGGTACAGAGTTTCAGTTGGG + Intergenic
1112059255 13:95721019-95721041 ATGGATGCAGAGTTTCAGTTTGG - Intronic
1112411229 13:99165346-99165368 ATGGGTACAGAGTCTTAGTTTGG + Intergenic
1112501230 13:99944889-99944911 AGGAAGACAGAGTTTTGGTTTGG + Intergenic
1112526137 13:100149423-100149445 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1112684835 13:101812960-101812982 ATTGAAAGAGAGTTTTAGCTGGG - Intronic
1113128636 13:107009179-107009201 AAGAATACATAATTTTTGCTGGG - Intergenic
1113215264 13:108032910-108032932 ACAGATACAGAGTTTTAGTTTGG - Intergenic
1114010954 14:18367976-18367998 ATGAGTACAGAGTTTCAGTTTGG - Intergenic
1114573393 14:23691642-23691664 ATTAAGACAGAGCTTTAGTTGGG - Intergenic
1114807938 14:25859323-25859345 ATGGGTACAGAGTTTTAACTGGG - Intergenic
1115317394 14:32039448-32039470 ATTCATACAGAATTTTAGATGGG - Intergenic
1115622074 14:35150494-35150516 ATGAATTCAGAATTTTAGGAAGG + Intronic
1115632316 14:35257320-35257342 ACGGATACAGAGTTTCAGTTTGG - Intronic
1115708786 14:36027110-36027132 ATGGATACAGTGTTTTAGTTTGG + Intergenic
1115959761 14:38822183-38822205 ATGGGTACAGAGTTTGAGATTGG - Intergenic
1116051021 14:39803270-39803292 ATGGATACAGAGTTTCAGTTTGG - Intergenic
1116585277 14:46695732-46695754 ATAATGACAGAGTTTTAGCTTGG - Intergenic
1116981184 14:51172508-51172530 ATGGGTACAGAATTTTAGTTGGG - Intergenic
1117653669 14:57932428-57932450 ATGCATACAAATTTTTAGGTAGG + Intronic
1118018755 14:61689378-61689400 CTGAGTACAGAATTTTAGATGGG + Intergenic
1118308355 14:64674653-64674675 AAAAATACAGAATGTTAGCTGGG + Intergenic
1118683376 14:68266286-68266308 ATAAATACACAGTTTTCCCTGGG - Intronic
1118885434 14:69861827-69861849 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1119343017 14:73896868-73896890 ATGAATCCAGAGTTCTAGAAAGG + Intronic
1121213291 14:92225974-92225996 ATGAGTACAGAGTTTTAGTTTGG - Intergenic
1121235311 14:92387674-92387696 ATGGGTACAGAGGTTCAGCTTGG - Intronic
1121921814 14:97888875-97888897 ATGAATGCATATTTTTGGCTAGG + Intergenic
1122020300 14:98832514-98832536 GTGAGGACAGAGTTTTAGTTTGG - Intergenic
1122150964 14:99726077-99726099 ATGAACACAGACTTTGAGCCAGG - Intronic
1123706123 15:22952253-22952275 GTGGATACAGAGTTTCGGCTTGG + Intronic
1124047822 15:26166602-26166624 ATGTGTACAGAGTTTCAGTTTGG - Intergenic
1124411515 15:29441342-29441364 CTGGATACAGAGTTTCAGTTGGG + Intronic
1124415420 15:29469602-29469624 ATGACTACAGAGTTTCAGCTTGG + Intronic
1124463755 15:29917950-29917972 ATAAGTACAGAGTTTCAGTTTGG - Intronic
1124873674 15:33569365-33569387 ATAAATACAGAGTTTCAGTTTGG - Intronic
1125134429 15:36325324-36325346 AAGATTACAGATTTTGAGCTAGG + Intergenic
1125785877 15:42317423-42317445 ATGATTACAGAGTTTCTGCTTGG + Intronic
1125988471 15:44079974-44079996 ATGGATACAGAGTTTCAGTTTGG + Intronic
1126221321 15:46217131-46217153 ATAAGTACCGAGTTTTAGCCAGG + Intergenic
1126296398 15:47141503-47141525 ATGGATACAAAATTTCAGCTAGG + Intergenic
1126335189 15:47579435-47579457 AAGAATACAGATTTCTGGCTGGG - Intronic
1126427520 15:48545570-48545592 AGGAATGGAGAGTTTTAGTTTGG + Intronic
1126581197 15:50243870-50243892 ATGGATACAGAGTTTCTGCTCGG + Intronic
1126984232 15:54284540-54284562 ATGAATACAGGGTTTGAGCTGGG + Intronic
1127602121 15:60548323-60548345 ATGGAGACAGTGTTTTCGCTTGG - Intronic
1127695829 15:61446279-61446301 ATGGATACAAAGTTTCAGTTTGG + Intergenic
1128021428 15:64394238-64394260 ATGTATACATATTTTTAGTTCGG + Intronic
1128473339 15:67975114-67975136 ATGGGTACAGAGTTTCAGTTGGG - Intergenic
1128914207 15:71545033-71545055 GTGAATACAGAGTTTCTGTTTGG + Intronic
1129437869 15:75556818-75556840 ATGGGTACAGAGTTTTTGCTGGG - Intronic
1130321487 15:82846160-82846182 ATGGAAACAGAGTTCTGGCTGGG - Intronic
1130574215 15:85076856-85076878 ATTAATACAAAGCTTTTGCTGGG - Intronic
1130630728 15:85566576-85566598 ATTAAAACAAAGTTTTAGTTGGG + Intronic
1130922010 15:88355203-88355225 ATGAGTACAGAGTTTGTGTTTGG - Intergenic
1131521632 15:93120660-93120682 ATGTATTAAGAGTTTTGGCTGGG + Intergenic
1131574024 15:93568349-93568371 ACTAATACAGGGTTTAAGCTGGG + Intergenic
1131587411 15:93710915-93710937 ATGGATACAGAGTCTCATCTTGG + Intergenic
1132057980 15:98666770-98666792 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1132094902 15:98976092-98976114 ATGAACACAGAGTGTTAGTGTGG + Intronic
1132303528 15:100791132-100791154 ATGAGTACAGAATTTCAGTTTGG + Intergenic
1132401951 15:101515549-101515571 ATGAATACAGAATTTCTGTTTGG - Intronic
1132913798 16:2330613-2330635 AGGAAAGCAGAGTTTCAGCTGGG - Intronic
1133199766 16:4196369-4196391 ATGGATACAGAGTTTTCAGTTGG - Intronic
1134806278 16:17128286-17128308 ATGAAGACAGAATAATAGCTAGG - Intronic
1135295364 16:21275033-21275055 ATGAATACAGGGATCTGGCTTGG + Intronic
1135357165 16:21778994-21779016 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1135455669 16:22595110-22595132 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1136094108 16:27941974-27941996 ATGACTACAGAGTTTCAGTTTGG + Intronic
1136575560 16:31122582-31122604 AAGAATTAAGAATTTTAGCTGGG + Intronic
1137295376 16:47087470-47087492 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1137689422 16:50411272-50411294 ATGGATACAGAGTTTCCGTTTGG - Intergenic
1137795987 16:51220522-51220544 ATGGGTACAGAGTTTTAGTTTGG - Intergenic
1137980988 16:53069393-53069415 ATGGGGACAGAGTTTCAGCTTGG - Intronic
1138144935 16:54600012-54600034 ATGGGTACAGAGTTTTTGCTGGG - Intergenic
1138639671 16:58374594-58374616 AGGAGTATAGAGTTTCAGCTTGG - Intronic
1139695748 16:68673393-68673415 ATGAGTACAGAGTTTCTGTTGGG - Intronic
1139791260 16:69438030-69438052 ATAAGTACAGAGTTTCAGTTTGG - Intronic
1139935298 16:70566175-70566197 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1139993298 16:70957095-70957117 ATGGGTACAGAGTTTCAGTTCGG - Intronic
1140436950 16:74954988-74955010 ATGAATAAAGGGTTTTACCCGGG + Intronic
1140446628 16:75034265-75034287 ATGGGTACAGAGTTATAGTTTGG - Intronic
1140627212 16:76808535-76808557 GTGGGTACAGAGTTTCAGCTTGG - Intergenic
1140627313 16:76809862-76809884 TTGAGTATAGAGTTTCAGCTTGG - Intergenic
1140967035 16:79976930-79976952 ATGAATGAAGAGTTTTGGTTTGG - Intergenic
1141135822 16:81464692-81464714 ATGGGTACAGAGTTTGTGCTGGG - Intronic
1142345183 16:89549502-89549524 AAGAATAAAGAGTATTAGCCAGG + Intronic
1203012129 16_KI270728v1_random:304742-304764 ATAAAAAGAGAGTTTTAACTTGG - Intergenic
1203030464 16_KI270728v1_random:577901-577923 ATAAAAAGAGAGTTTTAACTTGG - Intergenic
1203041257 16_KI270728v1_random:756530-756552 ATAAAAAGAGAGTTTTAACTTGG + Intergenic
1142477673 17:199154-199176 GTTAATCCAGAGTTTGAGCTGGG - Intergenic
1143673869 17:8416148-8416170 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1143702726 17:8673413-8673435 ATGGATACAGAGTTTCAGTTTGG + Intergenic
1143991166 17:10963480-10963502 ATGTGTACAGAATTTTAGTTGGG + Intergenic
1144310337 17:14008190-14008212 AATAAGACAGAGATTTAGCTGGG - Intergenic
1144716438 17:17439158-17439180 ATGAAAACAAAGTTTTTGTTTGG + Intergenic
1144798531 17:17909628-17909650 ATGAACACAGAATTTCAGTTTGG + Intronic
1145065854 17:19760776-19760798 ATGGACACAGAGTTTCAGTTTGG - Intergenic
1145376703 17:22356355-22356377 AAGAATGCAGAGTTTCAGTTTGG - Intergenic
1146390557 17:32418322-32418344 AAAAATACAAAGTATTAGCTGGG - Intergenic
1146497870 17:33338947-33338969 ATGGATACAGAGTTTCAGTTTGG + Intronic
1146971870 17:37079916-37079938 ATGAGTACAGAGTTTCAGTATGG - Intergenic
1147197389 17:38776378-38776400 ATGGGTATAGAGTTTCAGCTGGG + Intronic
1147529543 17:41262615-41262637 ATGAATACAGTGTATTAGGAAGG + Intergenic
1148024028 17:44573274-44573296 AAAAATACAAAATTTTAGCTGGG - Intergenic
1148032745 17:44633100-44633122 ATGAATATAGAGTTTTGTTTTGG + Intergenic
1148636922 17:49156130-49156152 ATGGGTACAGAGTTTCAGTTGGG - Intronic
1149330156 17:55572779-55572801 ATGGTTACAGAGTTTTTGTTTGG - Intergenic
1149523719 17:57338247-57338269 AAAAATACAGAAATTTAGCTGGG - Intronic
1149935085 17:60797053-60797075 AAAAATACAGAGAATTAGCTGGG - Intronic
1149971041 17:61218741-61218763 ATGAGGACAGAGACTTAGCTAGG + Intronic
1150045596 17:61910264-61910286 ATGGATACAGAGTTTCTGTTTGG + Intronic
1150188048 17:63206748-63206770 ATGGATACAGAATTTCAGTTGGG + Intronic
1150665838 17:67136810-67136832 ATGCATACAGAGTTTCAGTTTGG + Intronic
1150849024 17:68687019-68687041 ATGAATGCAGAGTCTGAGGTTGG + Intergenic
1150949784 17:69790091-69790113 ATTAATACAGAAAATTAGCTGGG - Intergenic
1151059760 17:71078478-71078500 TGGAATACAAAGTTGTAGCTGGG - Intergenic
1151217308 17:72586036-72586058 ATGGGTACAGAGTTTTAGTTTGG + Intergenic
1151418248 17:73980869-73980891 ATGAATACAGATTTGTAGGGAGG + Intergenic
1151847403 17:76666939-76666961 ATGGCTACAGAGTTTCAGTTGGG - Intergenic
1151953428 17:77368177-77368199 ATGAGGACAGAGTTTCAGTTTGG + Intronic
1152188179 17:78871683-78871705 AAAAATACAGAAATTTAGCTGGG + Intronic
1152364292 17:79846085-79846107 ATGAAGACAGAGTTTCAGTTTGG - Intergenic
1152613431 17:81327113-81327135 ATGAGTACAGAGTTTCTGTTTGG - Intronic
1153084248 18:1265079-1265101 ATGAGTGCAGAGTTTTAGTTGGG + Intergenic
1153358598 18:4166902-4166924 TTGGATACAGAGTTTCAGTTTGG + Intronic
1153883474 18:9440762-9440784 ATGGGTGCAGAGTTTCAGCTGGG + Intergenic
1153915339 18:9739856-9739878 AAGAACCCTGAGTTTTAGCTGGG - Intronic
1154233387 18:12579512-12579534 ATAAATACAGAGTTTCAATTTGG + Intronic
1154526884 18:15300007-15300029 ATGAGTACAGAGTTTCAGTTTGG + Intergenic
1155150000 18:23115685-23115707 ATGGGTACAGAGTTTCAGCTGGG - Intergenic
1155531356 18:26770290-26770312 ATGGGTACAGAGTTTCACCTGGG - Intergenic
1155891420 18:31275191-31275213 CTGAATAAGCAGTTTTAGCTTGG + Intergenic
1156323437 18:36050107-36050129 ATGGATACAAAGTTTCAGTTTGG + Intronic
1157016922 18:43726276-43726298 AACAATACAGTGTTTTAGTTAGG + Intergenic
1157525833 18:48381041-48381063 TTGGATATAGAATTTTAGCTTGG - Intronic
1157593479 18:48849984-48850006 ATGGGGACAGAGTTTCAGCTGGG - Intronic
1157876309 18:51276944-51276966 ATGGATATAGAGTTTCAGTTTGG - Intergenic
1157966261 18:52211678-52211700 ATAAATACCATGTTTTAGCTAGG + Intergenic
1158129572 18:54138161-54138183 ATGAATACTAAGTTTCAGTTGGG - Intergenic
1158170236 18:54590127-54590149 ATGAATACACAATTTCAGTTTGG - Intronic
1158317961 18:56232601-56232623 ATGAACACAGAATTTTACCCAGG + Intergenic
1158672374 18:59488215-59488237 ACGGATACAGAGTTTCAGTTTGG + Intronic
1158895207 18:61906249-61906271 ATGAATACAGAGTTCCAGTTTGG - Intergenic
1158965401 18:62618029-62618051 ATGGATACACAGTTTCAGTTTGG + Intergenic
1159006148 18:63014521-63014543 ACGGATACAGAGTTTCAGTTTGG - Intergenic
1159290356 18:66410729-66410751 GTGAATATATATTTTTAGCTTGG - Intergenic
1159392895 18:67817306-67817328 ATGAGTACAGAGATTCAGTTAGG - Intergenic
1159460516 18:68716915-68716937 AAGAATACAGAGAATTAGCTGGG + Intronic
1160624479 18:80193511-80193533 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1161371747 19:3916013-3916035 ATGGAGACAGAGTTTCAGTTTGG - Intronic
1161928959 19:7323371-7323393 ATGGAGACAGAGTTTCAGTTTGG - Intergenic
1161942111 19:7411725-7411747 ATGAGGACAGAGTTGCAGCTTGG - Intronic
1162038295 19:7954138-7954160 AAAAATACAAAGATTTAGCTGGG - Intergenic
1162872353 19:13595837-13595859 ATGGAGACAGAGTTTCAGTTTGG + Intronic
1162889678 19:13723446-13723468 ATGGGTACAGAGTTTCAGCTTGG + Intergenic
1164363088 19:27540254-27540276 ATCAATACAAAGGTTTAACTCGG - Intergenic
1164791670 19:30990761-30990783 ATGAAAGCAGAGTTCTTGCTTGG + Intergenic
1165016460 19:32884318-32884340 ATGAATACTTTGTTTTAGGTTGG + Intronic
1167002597 19:46755082-46755104 ATAAGTACAGAGTTTCAGTTTGG - Intronic
1167801865 19:51748345-51748367 ATGAATATGCAGTTTTTGCTTGG + Intronic
1167927250 19:52831468-52831490 ATAAATACAAACTTTTAGCCAGG - Intronic
1168512371 19:56983061-56983083 ATGGATGCAGAGTTTCAGTTGGG + Intergenic
925272087 2:2618065-2618087 ATGAGTACAGAGTTATAGTTAGG + Intergenic
925521275 2:4748191-4748213 GTGAATATAAAGTTTTAGCAAGG - Intergenic
925826614 2:7854953-7854975 AAAAATACAGAATATTAGCTGGG + Intergenic
926154592 2:10446433-10446455 AAGAATACTGAGTTCTAGCCGGG - Intronic
926175529 2:10588349-10588371 ATGGGTACAGAGTTTCAGGTTGG - Intronic
927122316 2:19977410-19977432 CAGTATCCAGAGTTTTAGCTTGG - Intronic
927261242 2:21093325-21093347 ATGAGTAGAGAGTTTCAGTTTGG - Intergenic
927795399 2:26043765-26043787 ATGATCACAGAGTTTTAGTTTGG + Intronic
927999422 2:27509635-27509657 AAAAATACAGTGTTTTGGCTAGG - Intronic
928163978 2:28955984-28956006 ATGGATACAGAGTTTCAGTGTGG - Intergenic
929181123 2:39040448-39040470 ATGGATACAGAGTTTCAGTTTGG - Intronic
929206786 2:39305082-39305104 ATGAGTATAGAGTTTTAGTTTGG + Intronic
929242010 2:39663580-39663602 ATGATCAAAGAGTTCTAGCTAGG + Intergenic
929488214 2:42373712-42373734 ATGAGTACAGAGTTTCAGTTGGG - Intronic
929634077 2:43498254-43498276 ATGAGTACAGAGCTTCTGCTCGG + Intronic
929964832 2:46526501-46526523 ATGGATACAGAGTTTAAATTTGG - Intronic
929986323 2:46736443-46736465 ATGAGTACAGAGTCTCAGTTGGG - Intronic
930112771 2:47693142-47693164 AATAATACATATTTTTAGCTGGG - Intergenic
930201045 2:48552371-48552393 ATGGGTGCAGAGTTTTAGTTTGG + Intronic
930253697 2:49064821-49064843 ATGAATACAGGGTTATGGTTTGG + Intronic
930341797 2:50125696-50125718 ATGAATACCAAGTTGTAGATGGG + Intronic
930962816 2:57281911-57281933 ATGAAGATAGAGTTATAGTTGGG - Intergenic
930968098 2:57357013-57357035 ATCAATACAGACTTAGAGCTAGG + Intergenic
930996050 2:57719751-57719773 ATGGGTACAGAGTTTCAGCTTGG + Intergenic
931057060 2:58484050-58484072 AAGAATACTGAATTTCAGCTAGG - Intergenic
931142940 2:59483650-59483672 AATAATACAGAGTTTCAGTTAGG + Intergenic
932346100 2:70996123-70996145 ATGGATACAGGGTTTCAGTTTGG + Intergenic
932399999 2:71473830-71473852 ATGGGTATAGAGTTTCAGCTGGG - Intronic
933044272 2:77515696-77515718 AAGTATGCTGAGTTTTAGCTTGG - Intronic
933282453 2:80346818-80346840 ATGAATACAGAATTTTAAATTGG - Intronic
933502333 2:83129786-83129808 CTGGATCCAGAGTTTTAGGTAGG + Intergenic
933714991 2:85353592-85353614 CTGAGAACTGAGTTTTAGCTTGG - Intronic
934936862 2:98472029-98472051 AGGAATCAAGAGTTTCAGCTGGG + Intronic
935188795 2:100759044-100759066 ATGAGTACAGAGTTTTAGTTTGG + Intergenic
935603195 2:104943341-104943363 ATAGATACAGAGTTGTAGTTAGG + Intergenic
936001000 2:108830281-108830303 ATGGATACAGAGTTTCATTTTGG + Intronic
936386815 2:112037911-112037933 CTGAGTATAGAGTTTTAGCTGGG + Intergenic
937030554 2:118735745-118735767 ATGAGTACAGAGTTTCAGTTTGG - Intergenic
937599048 2:123706684-123706706 GTGAATACAGAGTTTGTGTTTGG - Intergenic
938321036 2:130364187-130364209 ATGAATACAGAATTTCTGTTTGG - Intronic
938525981 2:132131364-132131386 ATGAGTACAGAGTTTCAGTTTGG + Intergenic
939778837 2:146419159-146419181 AAAAATACAAAATTTTAGCTGGG - Intergenic
940212743 2:151272959-151272981 ATGGGTACAGAGTTTCAGTTTGG + Intronic
940251662 2:151684090-151684112 ATGAATACAGAATTTCAGTCTGG + Intronic
940421483 2:153483902-153483924 ATGGGTACAGAGTTTGAGTTTGG + Intergenic
940801932 2:158142752-158142774 ATGAGCACAGAGTTTCAGTTTGG + Intergenic
940853612 2:158711705-158711727 ATGAGTATAGAGTTTTAGTTTGG - Intergenic
940854792 2:158721663-158721685 ATGAATATAGAGTTTAAGTTTGG + Intergenic
940887381 2:159001391-159001413 ATGAGTACAGAGTTTCAGTTGGG + Intronic
940981577 2:160009556-160009578 ATGGGTACAGAGTTTCAGTTTGG + Intronic
941092210 2:161190825-161190847 ATGGATACAGAGTTTCAGTTAGG + Intronic
941105093 2:161343183-161343205 ATGGGTACAGAGTTTCAGTTTGG - Intronic
941826974 2:169909531-169909553 AAGGGTACAAAGTTTTAGCTAGG + Intronic
941915111 2:170807029-170807051 ATGAGGACAGAGTTTCAGTTGGG - Intergenic
942364174 2:175205415-175205437 ATGGATACAGAATTTCAGTTTGG - Intergenic
942576462 2:177368732-177368754 ATGAATACAAAAAATTAGCTGGG - Intronic
942617492 2:177809133-177809155 ATGGGTACAGAGTTTCAGTTTGG + Intronic
943000819 2:182326582-182326604 ATGGATACAGAGTTTCAGTTTGG + Intronic
943009687 2:182432262-182432284 ATGACTACAGAGTTTATTCTTGG - Intronic
943437853 2:187889192-187889214 TTGGGTACAGAGTTTTAGTTTGG - Intergenic
943715480 2:191147532-191147554 AAGAGTACAGAGTTTCAGTTTGG + Intronic
944057778 2:195541317-195541339 ATGGATACAGAGTTTTTATTAGG + Intergenic
944155852 2:196606837-196606859 ATGAATACAGAGATTTGTTTTGG + Intergenic
944210729 2:197203976-197203998 ATGGATACAGAGTTTCATTTGGG + Intronic
944315503 2:198281194-198281216 ATGGTTACAGAGTTTCAGTTTGG - Intronic
944356796 2:198799636-198799658 ATGAGTACAGAGTTTTTGTTGGG - Intergenic
944357056 2:198802800-198802822 ATGAGTACAGAGTTTTTGCTGGG - Intergenic
944722280 2:202436151-202436173 ATGAAAACTTAGTTTTATCTTGG + Intronic
944733392 2:202537540-202537562 ATGGGTACAGAGTTTCAGTTTGG + Intronic
945455315 2:210045709-210045731 ATGAATACAGAATTCTGGGTTGG + Intronic
946993691 2:225365991-225366013 ATAGGTACAGAGTTTCAGCTTGG - Intergenic
947262554 2:228240260-228240282 AAGAATACAAAATTTTAGTTAGG - Intergenic
1169003532 20:2186996-2187018 ATAAATACAGACATTTAACTTGG - Intergenic
1169614791 20:7428452-7428474 AGGGATATAGAGCTTTAGCTTGG - Intergenic
1170027951 20:11911280-11911302 ATGTACACAGAGTTTTAGTTGGG + Intronic
1170443394 20:16400872-16400894 ATGAGTACAGAGTTTTAGTTTGG + Intronic
1170650210 20:18232583-18232605 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
1170712058 20:18800285-18800307 ATGGGTACAGAGTTTTAGTCTGG - Intergenic
1170781571 20:19430309-19430331 ATCAAAACAGAGTTTTCCCTTGG + Intronic
1171022298 20:21596750-21596772 CTGAATACAGAATTTCAGGTTGG + Intergenic
1172253838 20:33499120-33499142 GTGAATCCAGAGTTTTAGGCAGG + Intronic
1172422888 20:34832355-34832377 ATGAATACAAAGTTTCAGTTGGG + Intergenic
1172651595 20:36506783-36506805 ATGGGTACAGAATTTCAGCTGGG - Intronic
1172709262 20:36908033-36908055 AAAAATACAAAGTATTAGCTGGG - Intronic
1173573628 20:44095732-44095754 ATGAATACAGAGGGTGAGCTGGG - Intergenic
1174525409 20:51166571-51166593 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
1175000254 20:55620148-55620170 ATGAGCACAGATTTTCAGCTGGG + Intergenic
1175386704 20:58600573-58600595 ATTAAGACAGATTTTTAGCCAGG + Intergenic
1175705993 20:61177154-61177176 ATGGATACAGAGTTTATGCTTGG + Intergenic
1176770552 21:13068498-13068520 ATGAGTACAGAGTTTCAGTTTGG - Intergenic
1177687248 21:24452845-24452867 ATGAATAGATATTTTTAACTTGG - Intergenic
1178099038 21:29246129-29246151 ATGAATACAAAATTTTAATTGGG - Intronic
1180435448 22:15298780-15298802 ATGAGTACAGAGTTTCAGTTTGG - Intergenic
1180517644 22:16162591-16162613 ATGAGTACAGAGTTTCAGTTTGG - Intergenic
1180575909 22:16774118-16774140 AAGAATACAAAAATTTAGCTTGG - Intergenic
1181046887 22:20219132-20219154 ATGGATACAGAGTTTCAGTTTGG - Intergenic
1181433523 22:22897013-22897035 ATAGATGCAGAGTTTGAGCTTGG - Intergenic
1182113015 22:27736639-27736661 ACGAGTACAGATTTTAAGCTGGG - Intergenic
1182672008 22:32004304-32004326 ATGGATACAGAGTTTCTGTTTGG - Intergenic
1184016465 22:41789603-41789625 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1184267014 22:43353627-43353649 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
1184429936 22:44436719-44436741 ATGAAGACAGAGTTTCAGTTTGG - Intergenic
1184933380 22:47698644-47698666 ATGGGTACAGAGTTTTACTTTGG - Intergenic
949118088 3:353491-353513 ATGAATACAGATATTTAACTTGG + Intronic
949324606 3:2849283-2849305 AGGGATACAGAGTTTCAGTTTGG + Intronic
949819220 3:8097563-8097585 ATGAGTACAGAGTTGCAGCCTGG - Intergenic
949958951 3:9295762-9295784 ATGGGTACAGAGTTTCAGTTTGG - Intronic
950374401 3:12558441-12558463 AGGAATACAGAGGTTTTTCTAGG - Intronic
951163666 3:19458703-19458725 AAGGATACAGAGTTTAAGCTAGG - Intronic
951229944 3:20166606-20166628 ATGGGTATAGAGTTTTAGTTTGG + Intronic
951602236 3:24389159-24389181 ATGAATACAGATTTTTGGAGTGG + Intronic
952121439 3:30249450-30249472 AAGAACACAGAGTTTTCGCTAGG - Intergenic
952292907 3:32035913-32035935 ATGGATACAGAGTTTCAATTTGG - Intronic
952796838 3:37246639-37246661 GTGGGTACAGAGTTTTAGTTTGG + Intronic
952821366 3:37488943-37488965 ATGGGTACAGAGCTTTAGTTTGG - Intronic
953602688 3:44383569-44383591 ATGTGTACAGAGTTTGAGTTGGG + Intronic
953812785 3:46129024-46129046 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
953951651 3:47195413-47195435 ATGAATACAAAGTTCTTGTTTGG - Intergenic
954097487 3:48340531-48340553 ATGAATTCAGAGTTTTTCCTGGG - Intergenic
954354737 3:50075474-50075496 TTGAATACTGGGTTATAGCTTGG + Intronic
954743494 3:52773330-52773352 ATGGGTGCAGAGTTTTAGCTGGG + Intergenic
954770558 3:52964136-52964158 AAAAGTACAGGGTTTTAGCTGGG - Intronic
955101426 3:55853785-55853807 ATGAGTGCAGAGTTTCAGTTTGG + Intronic
955665536 3:61345733-61345755 TGGTATATAGAGTTTTAGCTGGG + Intergenic
955944564 3:64180429-64180451 ATGAGTACAGAGTTTCAGTATGG - Intronic
955959803 3:64328559-64328581 AGGATTTCAGAGTTTTAGGTAGG + Intronic
956064288 3:65380471-65380493 ATGAGTACAGAGTTTCAATTTGG - Intronic
956120995 3:65965813-65965835 AAAAATACAGAATATTAGCTGGG - Intronic
956443675 3:69305025-69305047 ATGTATAAAGAGTTCCAGCTTGG - Intronic
956763049 3:72460494-72460516 ATGAATACAGTGTGTTATTTGGG + Intergenic
957898131 3:86450102-86450124 GTGCATAGAGAGTTTTAGCAAGG - Intergenic
958774742 3:98468448-98468470 ATGGTTACAGAGTTTCAGTTTGG - Intergenic
958883501 3:99699703-99699725 GTGATTAAAAAGTTTTAGCTCGG - Intronic
959036823 3:101376224-101376246 ATAGATACAGAGTTTCAGTTTGG + Intronic
959037117 3:101380197-101380219 ATAGATACAGAGTTTCAGTTTGG + Intronic
959735955 3:109658842-109658864 ATGGATATAGAATTTTAGTTTGG + Intergenic
959915561 3:111813173-111813195 AAGGATACAAAGTTTCAGCTTGG + Intronic
960747139 3:120902426-120902448 ATGAAGACAGAATTTTTGATTGG + Intergenic
961126629 3:124424544-124424566 CTGAATACAGATCTTTAGCATGG - Intronic
961617107 3:128191582-128191604 ATGGGTACAGAGTTTCAGTTTGG - Intronic
961765862 3:129210478-129210500 ATGAGTACAGAGTATCAGTTTGG + Intergenic
961987819 3:131156670-131156692 AGTAATACAGAGTATTACCTGGG - Intronic
962106902 3:132399672-132399694 ATTTGGACAGAGTTTTAGCTAGG - Intergenic
962111865 3:132459448-132459470 ATGATTACAGAGTTTCAGTTTGG + Intronic
962365864 3:134780369-134780391 ATGAGTACAGAGTTTCTGTTTGG - Intronic
962457548 3:135578773-135578795 ATGAATACACAGGGTTAGTTGGG - Intergenic
962804743 3:138918739-138918761 AAGAATACAGAAAATTAGCTGGG + Intergenic
962815227 3:138991711-138991733 ATGAATAAAAAGTTTTGGTTAGG - Intergenic
963670932 3:148251397-148251419 ATAAATATAGAGTTTTTTCTTGG - Intergenic
963749276 3:149158997-149159019 ATGAAGATAGAATTATAGCTTGG + Intronic
964692690 3:159469346-159469368 ATGAAGCCCTAGTTTTAGCTTGG - Intronic
965206476 3:165724582-165724604 ATAAATGCATAGTTTTAGGTGGG - Intergenic
965233209 3:166080559-166080581 ATGAATATAAAGTTTTAGAATGG - Intergenic
966412797 3:179660242-179660264 ATGGATACAGAGTTTCAGTTTGG - Intronic
966629977 3:182061719-182061741 ATTCATAAAGAGTTTTAGATAGG + Intergenic
966697987 3:182812841-182812863 ATGAGTACAGAGTTTCAGGCTGG - Intronic
966838881 3:184072098-184072120 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
966905094 3:184516878-184516900 ATGCATACAGAGTTTTTACTGGG + Intronic
967663879 3:192148473-192148495 ATGAGTACAGAGTTTCAGTTGGG + Intronic
968200547 3:196750998-196751020 ATGAGTACCGAGTTTCAGTTGGG - Intronic
968819748 4:2841891-2841913 ATGGGTACAGAGTTTAAGCTTGG - Intergenic
969136391 4:5032755-5032777 ATGGGGACAGAGTTTCAGCTTGG - Intergenic
969918287 4:10511477-10511499 ATGGATACAGAGTTTCAGTTTGG - Intronic
969923351 4:10561194-10561216 ATGAAGAGGGAGTTTTAGCCAGG - Intronic
970469267 4:16360516-16360538 ATGTAGACAGAGTTGGAGCTGGG - Intergenic
971368527 4:25996379-25996401 ATGGATACAGACTTTCAGCTGGG - Intergenic
971392473 4:26199044-26199066 ATGGGTGCAGAGTTTTAGTTGGG - Intronic
971411382 4:26376245-26376267 ATGAGCACAGAGTTTCAGTTTGG - Intronic
971434290 4:26603926-26603948 ATGGGTACAGAGTTTCAGCTTGG - Intronic
971443539 4:26716939-26716961 AGAAATACAGAGTATTGGCTGGG - Intronic
971511530 4:27432342-27432364 ATGACTACAGAGTTTCATTTTGG + Intergenic
971700491 4:29967245-29967267 GTGAATACTGTCTTTTAGCTTGG + Intergenic
974759157 4:66253000-66253022 AAGAATACACAGTTTTGTCTTGG + Intergenic
974773321 4:66444862-66444884 ATGGGTACAGAGTTTTAGTTTGG + Intergenic
974890109 4:67871156-67871178 ATGAATAAAGACTCTTGGCTTGG - Intronic
975242027 4:72071262-72071284 ATGAATTCATAGTCTCAGCTAGG - Intronic
975636256 4:76452344-76452366 ATGGATACAGAGTTTCAGTTTGG - Intronic
975927125 4:79470573-79470595 ATTAATACAAAGTTTCAGTTTGG - Intergenic
976171068 4:82304844-82304866 ATGTGTACAGAGTTTCAGTTTGG + Intergenic
976280751 4:83324793-83324815 ATGGGTACAGAGTTTCAGTTTGG + Intronic
976384802 4:84444471-84444493 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
976564057 4:86533276-86533298 ATGGGTACAGAGTTTCAGCATGG + Intronic
976705187 4:88012684-88012706 ATGAGTACAGAGTTTCTGTTTGG - Intronic
977550697 4:98439955-98439977 ATGAGTACAGAGTTTCAGTTTGG - Intronic
977727658 4:100315950-100315972 ATGATTGCAGAGTTTCAGTTTGG - Intergenic
977749969 4:100597772-100597794 ATGAATACAGAGTTTCAGTTTGG - Intronic
977809230 4:101339768-101339790 TTGTATTCAGAGTTTTAGTTTGG - Intronic
977854139 4:101867285-101867307 CTGAATATAGAATTTTAGATTGG - Intronic
978275780 4:106948045-106948067 ATGGATACAGAGTTTTATTTAGG - Intronic
978477892 4:109152906-109152928 ATGGGTACAGAGATTCAGCTGGG + Intronic
978786499 4:112615555-112615577 AAGAATACAAAGTTCTAGCATGG - Intronic
978822068 4:112978440-112978462 ATGTGTACAGAGTTTCAGTTTGG - Intronic
980102008 4:128551249-128551271 ATCACTACAGTGTTCTAGCTGGG - Intergenic
980603441 4:135057884-135057906 ATGAATTCAGAGCTTTAAGTGGG - Intergenic
981098831 4:140809085-140809107 ATGAGTACAGAGTTTTAGTCTGG - Intergenic
981523208 4:145686276-145686298 ATGAATATAGAGTTTTTGTTTGG + Intronic
981553803 4:145969587-145969609 ATGAATATAGAGTTTTAGTTTGG + Intergenic
981936719 4:150247334-150247356 ATGAATGCAGAGTTTCGGTTTGG - Intronic
982253960 4:153434554-153434576 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
982271787 4:153597770-153597792 AAAAATACAAAGTATTAGCTGGG + Intronic
982474211 4:155830715-155830737 ATGCGTACAGAGTTTCAGTTAGG - Intronic
982854850 4:160368476-160368498 ATGGATACAGAGTTTGAGTTTGG + Intergenic
983075350 4:163318801-163318823 AAGGATACAGAATTCTAGCTTGG + Intergenic
983187905 4:164721726-164721748 ATGGGTACAGAGTTTCAGATTGG - Intergenic
983571897 4:169217715-169217737 ATGGATACAGAGTTTTAGCTGGG + Intronic
983933231 4:173475954-173475976 ATGGATATAGAGTTTCAGTTTGG + Intergenic
984279257 4:177648813-177648835 CAGTATACAGAGTTTTAGTTCGG + Intergenic
984298315 4:177882872-177882894 ATGAATACTGCGTGTTAGCATGG - Intronic
984897151 4:184551446-184551468 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
984957432 4:185059324-185059346 ATGAGCACAGAGTTTCTGCTTGG - Intergenic
985107791 4:186515738-186515760 ATGGGTACAGAGTTTCAGCTGGG + Intronic
985172457 4:187166447-187166469 ATGGGTATAGAGTTTCAGCTGGG + Intergenic
985243827 4:187959311-187959333 ATGGGTACAGAGTTTCAGTTGGG - Intergenic
985960304 5:3297380-3297402 ATGGAGACAGAGTTTTAGTTTGG - Intergenic
986850506 5:11807076-11807098 AATAATACAGAGTTTAAGCAGGG - Intronic
987016099 5:13820928-13820950 ATGAGTACAGAGTTTCAATTTGG + Intronic
989005138 5:36801679-36801701 ATGAGTACAGAGTTTCTGTTTGG + Intergenic
989488696 5:42024081-42024103 ATGAAGAAAGAATTTTACCTGGG - Intergenic
989659635 5:43786429-43786451 AAGAATACAGAATTTCAGTTAGG + Intergenic
990132340 5:52601454-52601476 GTGAACACAGACTTTCAGCTTGG + Intergenic
990432292 5:55747693-55747715 ATGAGTACAGAGTTCCAGTTTGG - Intronic
991064405 5:62410524-62410546 AAAAATACAGAAATTTAGCTGGG - Intronic
991270889 5:64779642-64779664 ATGGATACAGAGTTTTCTTTTGG - Intronic
991656250 5:68906545-68906567 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
991779922 5:70122447-70122469 ATGGATACAGAGTTTTCTTTGGG + Intergenic
991811490 5:70479408-70479430 ATGGATACAGAGTTTTCTTTGGG - Intergenic
991859209 5:70997875-70997897 ATGGATACAGAGTTTTCTTTGGG + Intronic
991872369 5:71122768-71122790 ATGGATACAGAGTTTTCTTTGGG + Intergenic
991928615 5:71729782-71729804 ATGGGTACAGAGTTTTTGTTGGG - Intergenic
992304907 5:75426806-75426828 ATGGACACAGAGTTTCAGCTGGG + Intronic
992938839 5:81741356-81741378 ATGAGTACAGAGTTTCAGTCTGG + Intronic
993154387 5:84204202-84204224 ATAAATGCATAGTTTTTGCTTGG - Intronic
993321135 5:86468389-86468411 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
993777987 5:92025913-92025935 ATCAATACAGTGTTTTACGTAGG + Intergenic
994296139 5:98090605-98090627 AAGGATACAAAATTTTAGCTAGG - Intergenic
994727842 5:103457393-103457415 ATGGGTACAGAGTTTCAGTTGGG - Intergenic
994810644 5:104514368-104514390 ATGAATACTGACTTTTCACTGGG + Intergenic
994938760 5:106291832-106291854 CTGAGTACAGAGTTGTAGTTTGG - Intergenic
994963135 5:106630135-106630157 AAGGATACAGAGTTTCAGTTAGG + Intergenic
996269821 5:121589815-121589837 ATGAGTACAAAGTTTCAGTTAGG + Intergenic
997169844 5:131706114-131706136 ATGGATACAGAGTTTCAGCTGGG + Intronic
997205635 5:132047545-132047567 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
997329563 5:133050073-133050095 AGGGATACAGAGTTTCAGTTTGG - Intergenic
997897402 5:137731958-137731980 ATGGATAGAGAGTTTCAGTTTGG - Intronic
998147279 5:139737020-139737042 ATGAAAATAGAATTTTAGCTGGG + Intergenic
998165587 5:139841007-139841029 ATGTGTACAGAGTTTCAGTTTGG - Intronic
998332044 5:141337646-141337668 ATAAGTACAGAGTTTCAGTTGGG + Intronic
998427083 5:142038006-142038028 AATGATACAGAGTTTTAGTTTGG + Intergenic
998801111 5:145870196-145870218 ATGGATACAGAGTTTCAATTTGG - Intronic
999509970 5:152239871-152239893 ATGAGTACAGAGTTTCTGTTTGG + Intergenic
999695807 5:154188128-154188150 ATGGGTACAGAGTTTCAGTTGGG + Intronic
999794555 5:154976943-154976965 ATGGATACAGAGTTTCAGATGGG - Intergenic
999795248 5:154982802-154982824 ATGGGTACAGAGTTTCAGTTGGG - Intergenic
999854860 5:155583171-155583193 ATGTATACAAAGTTTTTGTTTGG + Intergenic
1001047454 5:168385711-168385733 ACGAGTACAGAGTTTCAGTTTGG + Intronic
1001665726 5:173432261-173432283 ATGAGTGCAGAGTTTTTGTTGGG - Intergenic
1001687075 5:173601686-173601708 AAGGGTACAGAGTTTTAGATTGG + Intergenic
1001781564 5:174373443-174373465 ATGAATATAGAGTTTCAATTGGG + Intergenic
1002147929 5:177200535-177200557 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1002325314 5:178400961-178400983 ATGGGTACAGAGTTTTTGTTTGG - Intronic
1002372314 5:178765021-178765043 ATGGGTACATAGTTTTAGTTTGG - Intergenic
1002782168 6:375375-375397 ATGAAAACACACTTTTAGCCAGG + Intergenic
1003003385 6:2358382-2358404 ATGGGTACAGAGTTTTGGTTTGG - Intergenic
1003110123 6:3246345-3246367 ATGGGGACAGAGTTTTAGTTTGG - Intronic
1003531843 6:6943633-6943655 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1003549329 6:7088193-7088215 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
1003599826 6:7506818-7506840 CTGAAAACAGAGTCTTGGCTAGG + Intergenic
1004204204 6:13575763-13575785 AAGGATACAAAGTTTTAGTTAGG - Intronic
1004813475 6:19286636-19286658 ATGAATACAGAGTTTCCATTTGG + Intergenic
1004953050 6:20695896-20695918 ATGGGTACAGAGTTTTAGTTTGG - Intronic
1004964175 6:20828818-20828840 ATGAGTACAGAGTTTTAGGTTGG - Intronic
1005036346 6:21558545-21558567 ATGAGTACAGAGTTTCTGCTTGG - Intergenic
1005062529 6:21790345-21790367 ATGGGTACAGAGTTTCAGGTTGG - Intergenic
1005320840 6:24651986-24652008 ATGGGTACAGAGTTTCAGTTGGG - Intronic
1005437081 6:25825407-25825429 TTGAATACAGAATTCTAGGTTGG + Intronic
1005887642 6:30108900-30108922 ATGAATGCAGAGTTAGAGGTGGG + Intronic
1005911763 6:30316379-30316401 CTGAATAAAAAATTTTAGCTGGG - Intergenic
1006476901 6:34261611-34261633 ATGTGTACAGAGTTTCAGTTTGG + Intergenic
1006589991 6:35147937-35147959 ATGATTACAGAGTTTTTGTTGGG - Intronic
1006874990 6:37287516-37287538 ATGGATACAGAGTTCCAGTTTGG - Intronic
1007102371 6:39258239-39258261 GTGAATACAGAGTTTCTGTTTGG - Intergenic
1007238476 6:40408099-40408121 GTGAGTACAGAGTTTTAGTTTGG + Intronic
1007544499 6:42682275-42682297 ATGAGTACAGAGTTTCAGTTGGG + Intronic
1007650212 6:43414752-43414774 ATGTGTACAGAGTTTCAGTTTGG + Intergenic
1007792896 6:44323070-44323092 ATGGATACAGAGTCTTATTTCGG + Intronic
1008006140 6:46411354-46411376 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1008169300 6:48182889-48182911 TTGATTACAGAGTTTTTGTTGGG + Intergenic
1008301489 6:49846012-49846034 ATGAGTACAGAGTTTCGGTTTGG + Intronic
1008608163 6:53160656-53160678 ATGCGTACAGAGTTTCAGTTTGG - Intergenic
1009421046 6:63465339-63465361 AAAAATACAAAGATTTAGCTGGG - Intergenic
1009611780 6:65953446-65953468 ATGATTAATGAGTTTTACCTTGG - Intergenic
1010273908 6:73947826-73947848 ATGAATCCAGGGTGTTGGCTGGG + Intergenic
1010475958 6:76287583-76287605 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
1011190515 6:84723113-84723135 ATGAGTACAGAGTTTGAGTTTGG - Intronic
1011627240 6:89293323-89293345 ATGAATATAGAGTTTCTGTTTGG + Intronic
1011749100 6:90437575-90437597 ATGAGTACAGAGTTTCATCTGGG - Intergenic
1012128686 6:95463295-95463317 ATGATTATAGAGTTTTATTTTGG - Intergenic
1012479020 6:99647494-99647516 ATGGATCTAGAGTTTAAGCTAGG + Intergenic
1012657603 6:101844951-101844973 ATGGATACAGAGTTTTCTTTAGG - Intronic
1012934906 6:105356897-105356919 TGGAATACAGATTTTTAGATTGG - Intronic
1013252860 6:108352076-108352098 ATGGACACAGAGTTTCAGTTTGG - Intronic
1014165274 6:118217495-118217517 ATGGGTACAGAGTTTTAGAATGG + Intronic
1014250536 6:119111388-119111410 ATGGATACAGAGTTTCAGTTGGG + Intronic
1014394806 6:120913533-120913555 ATATAAACAGAGTTTTAACTAGG - Intergenic
1014998339 6:128181815-128181837 TTAAATACAGAGTGTTAGTTAGG - Intronic
1015618236 6:135101785-135101807 ATGGATACAGAGTTTCATTTTGG - Intronic
1016407869 6:143749419-143749441 GTAAATGCAAAGTTTTAGCTTGG + Intronic
1017646518 6:156544235-156544257 ATGAGTACAGAGTTTCAGTTTGG - Intergenic
1018633399 6:165839952-165839974 ATGAAGACAGAGATGTAGATGGG - Intronic
1020373481 7:7460217-7460239 ATCCATCCAGAGTTTTAGCAAGG - Intronic
1020667699 7:11068556-11068578 AGGGGTACAGAGTTTCAGCTGGG + Intronic
1020684062 7:11271814-11271836 AGGAATTCAGATTTTTAGCATGG + Intergenic
1021514070 7:21463701-21463723 TTGAAGACAGAGTTTGAGCTGGG + Intronic
1021848638 7:24786682-24786704 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1021922767 7:25503249-25503271 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1021981395 7:26059048-26059070 ATTAATATGGAGTTCTAGCTGGG + Intergenic
1022313236 7:29217603-29217625 ATGAATACAAATATTTAGTTGGG + Intronic
1022425414 7:30264264-30264286 ATGGATACAGAGTTTCTGTTTGG - Intergenic
1022597612 7:31727744-31727766 ATAAATTAAGAGTTTCAGCTGGG + Intergenic
1022697148 7:32718445-32718467 ATGCATACAAAGTTTCAGTTAGG + Intergenic
1022797121 7:33741020-33741042 ATGGATATAGAGTTTCAGTTTGG - Intergenic
1022933658 7:35149532-35149554 ATGTATACAAAGTTTCAGTTAGG + Intergenic
1023200247 7:37689023-37689045 ATGAGTAAAGAGTTTTAGTCTGG - Intronic
1023223980 7:37949988-37950010 ATGGAGACAGAGTTTCAGTTTGG + Intronic
1023341238 7:39222526-39222548 ATGGGTACAGAGTTTCAGCTGGG - Intronic
1023596768 7:41837704-41837726 ATGGATACAAAGTTTTAGTTTGG - Intergenic
1023786479 7:43713435-43713457 ATGAGTACAAAGTTATAGTTAGG - Intronic
1023887664 7:44372344-44372366 ATGAATATGGAGTTTCAGTTTGG + Intergenic
1024050559 7:45619756-45619778 AAGAATACAAAATTTTAGTTAGG + Intronic
1024815142 7:53260164-53260186 ATGGTTTCAGAGTTTTAGTTTGG - Intergenic
1024960163 7:54966035-54966057 ATGGGTACAGAGTTTCTGCTTGG - Intergenic
1025067172 7:55867250-55867272 ATGGATATAAAGTTTTAGTTTGG - Intergenic
1025529004 7:61853003-61853025 ATAAAAAGAGAGTTTTAACTTGG + Intergenic
1025588170 7:62819656-62819678 ATGAAAAGAAAGTTTTAACTTGG - Intergenic
1027026978 7:74859966-74859988 ATGAATACAGAGTTTCTATTAGG + Intergenic
1027060774 7:75084138-75084160 ATGAATACAGAGTTTCTATTAGG - Intergenic
1028268054 7:88752674-88752696 AAGGATACAGAGTTTTAGATAGG + Intergenic
1028283507 7:88964550-88964572 ATGCATACAGAGTTTCAATTGGG + Intronic
1028924349 7:96341318-96341340 ATGGATACAGAGTTTCTGTTTGG - Intergenic
1028930392 7:96406734-96406756 ATGAGTACAGAGGTTTTGTTAGG + Intergenic
1028986733 7:97015384-97015406 ATGAATACAGAGAATTTCCTAGG + Intergenic
1029411344 7:100413383-100413405 GTGAAGAAAGAGTTTTAGGTAGG - Intronic
1029712774 7:102308610-102308632 GGGAATACAGAGTGTGAGCTGGG + Intronic
1029829589 7:103242302-103242324 ATGCATACAAAGTTTCAGTTAGG + Intergenic
1030043726 7:105475808-105475830 ATGGGTATAGAGTTTCAGCTGGG - Intronic
1030199103 7:106884436-106884458 ATGGGTACAGAGTTTCAGCTGGG - Intronic
1030243652 7:107358738-107358760 ATGAGTCCAGAGTTTTATCAGGG - Intronic
1030250342 7:107436474-107436496 ATGACTACAGAGTTTCAGGTTGG + Intronic
1030619324 7:111772122-111772144 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1030789408 7:113705573-113705595 ATGTGTACAGAGTTTCAGTTTGG + Intergenic
1030963863 7:115963787-115963809 ATGAGTACAGAGTTTTTGTTTGG + Intronic
1031107949 7:117568860-117568882 AAGAGTACAAAGTTTTAGTTAGG - Intronic
1031112162 7:117624184-117624206 TTGAATTCAGAGATTTTGCTGGG + Intronic
1031550397 7:123104651-123104673 CTGAAGAAAGAGTTTTAGCAAGG + Intergenic
1032122206 7:129165102-129165124 ATGGATACAGAGTTTCATCTGGG - Intronic
1032596747 7:133248659-133248681 ATGGATACAGAGTTTCATTTTGG - Intergenic
1033432572 7:141302522-141302544 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1033806539 7:144960571-144960593 CAGAAGACAGAGTTTTATCTAGG + Intergenic
1034146517 7:148878232-148878254 ATGAATACAGAGTTTCTGTTTGG - Intronic
1034333263 7:150301892-150301914 ATGGGGACAGAGTTTTAGTTTGG + Intronic
1034680985 7:152927151-152927173 AAGAATACAGAATTTCAGTTAGG + Intergenic
1036126810 8:6070409-6070431 ATGAACAAAGAGTTTCATCTCGG - Intergenic
1036137710 8:6176860-6176882 ATGGGTGCAGAGTTTCAGCTGGG + Intergenic
1036461383 8:8956255-8956277 ATGAGTGCAGAGTTTCAGTTTGG - Intergenic
1036654261 8:10666049-10666071 ATGCATACAGAGTTTCAGTTTGG + Intronic
1036729872 8:11253311-11253333 ATGAAAACAGAGTTTTAGTTTGG + Intergenic
1036769543 8:11569575-11569597 ATGGAGACAGAGTTTCAGTTTGG - Intergenic
1037657345 8:20896502-20896524 AAGAAAACAGAGTTGTTGCTGGG + Intergenic
1038155549 8:24985983-24986005 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
1038230845 8:25698124-25698146 ATGAGTACAGAGTTTCAGTTTGG + Intergenic
1038312938 8:26458987-26459009 ATGTTTACAGAGCTTTAGTTTGG + Intronic
1038371306 8:26994578-26994600 ATGGGTGCAGAGTTTCAGCTGGG + Intergenic
1038566996 8:28627956-28627978 ATGGGTACAGAGTTTCAGCCTGG + Intronic
1038763173 8:30403629-30403651 GTGTATACACAGATTTAGCTAGG - Intronic
1039001620 8:32987473-32987495 CTACATACAGAGTTTTGGCTAGG - Intergenic
1039294557 8:36135782-36135804 ATGGATATAGAGTTTCAGTTTGG + Intergenic
1039677946 8:39690652-39690674 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1039953995 8:42193515-42193537 ATGGCTACAGAGTTTCAGTTAGG - Intronic
1040361298 8:46666821-46666843 ATGGATATAAAGTTTTAGTTTGG + Intergenic
1040525618 8:48221832-48221854 CTGAATACAAAATTTTAGGTTGG + Intergenic
1040856188 8:51950449-51950471 ATGAGTCCAGAGTTTCAGTTTGG + Intergenic
1042223443 8:66495876-66495898 ACGGATTCAGAGTTTTAGTTTGG - Intronic
1042474430 8:69231040-69231062 ATCAATACAGAGTTCTACCTAGG - Intergenic
1042567068 8:70122550-70122572 AGAAATACAGACTTTTAGCCTGG - Intronic
1043341230 8:79242088-79242110 ATGAGTACAAATTTTTAGCTAGG + Intergenic
1043404105 8:79913318-79913340 ATGGATACAGAGTTTCAGTTTGG + Intergenic
1043865793 8:85373954-85373976 ATGAATATGGAGTTTCAGTTTGG + Intronic
1044667384 8:94643539-94643561 ATGAGTACAGAATTTCAGTTTGG + Intronic
1045076260 8:98572321-98572343 ATGAACACAAAGTTTAATCTAGG - Intronic
1045119446 8:99019600-99019622 ATGGATACAGAATTTCAGTTTGG - Intronic
1045194752 8:99919233-99919255 ATGGGTACAGAATTTCAGCTTGG + Intergenic
1045431543 8:102119438-102119460 GTGGAAACAGAGTTTCAGCTGGG + Intronic
1045485088 8:102624849-102624871 ATAGATACAGAGTTTCAGTTTGG - Intergenic
1046020544 8:108659679-108659701 GTGAATATAGAGTTCTATCTTGG - Intronic
1046168753 8:110476636-110476658 ATAGGTACAGAGTTTTAGTTGGG - Intergenic
1047742098 8:127814798-127814820 ATGAGTGCAGAGTTTCAGTTTGG - Intergenic
1047820976 8:128520306-128520328 ATGAAGAAAGAGTTTTAGAGAGG - Intergenic
1048103866 8:131385825-131385847 ATGGGTACAGAATTTCAGCTTGG + Intergenic
1048330654 8:133468496-133468518 ATGGGGACAGAGTTTTTGCTTGG + Intronic
1049866344 8:144940237-144940259 AAGAATACAGAAAATTAGCTGGG - Intronic
1050256023 9:3793017-3793039 ATGGATACAGAGTTTCAGGTGGG + Intergenic
1050513691 9:6420214-6420236 AGAAATACAAAGTATTAGCTGGG - Intronic
1051166086 9:14263551-14263573 ATGTATACAGGGTTTGAGCCAGG - Intronic
1051435621 9:17027618-17027640 ATGTATACAGAATTTTAGGCTGG - Intergenic
1051480943 9:17559913-17559935 ATGAAAACAGAATTTTAGATTGG - Intergenic
1051733165 9:20169213-20169235 ATGAGTACAGAGTTTATGCTGGG + Intergenic
1052289390 9:26824940-26824962 ATGAAAACATAGTTGTATCTTGG + Intergenic
1052816418 9:33105583-33105605 ATGAGTACAGAGTTTTAGTTGGG - Intronic
1053506186 9:38645422-38645444 ATAAATACAAAATATTAGCTGGG - Intergenic
1053704669 9:40738712-40738734 ATGAGTACAGAGTTTCAGTTTGG + Intergenic
1054414749 9:64862319-64862341 ATGAGTACAGAGTTTCAGTTTGG + Intergenic
1054948435 9:70822576-70822598 ATGAGTACAGAGTTACAGTTTGG + Intronic
1055028817 9:71751215-71751237 ATGGATATAGAGTTTTTGTTTGG - Intronic
1055454926 9:76463367-76463389 ATGAATAAAGAGTTTCACCAGGG - Intronic
1055536557 9:77252604-77252626 TTGAGTACAGAGTTTCAGTTTGG - Intronic
1055875947 9:80941643-80941665 GTGATTATAGAATTTTAGCTTGG - Intergenic
1056083719 9:83123926-83123948 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
1056502681 9:87225285-87225307 ATAAATACGCAGCTTTAGCTGGG + Intergenic
1056538692 9:87553008-87553030 ATGGATACACAGTTTCAGCTTGG - Intronic
1057539507 9:95953099-95953121 ATGAGTACAGAGTTTCAGTTTGG + Intronic
1057673425 9:97116508-97116530 ATGGATACAGAATTTCAGTTTGG + Intergenic
1058366051 9:104209652-104209674 ATGAAGACAGTCTTTTACCTAGG + Intergenic
1058592014 9:106575397-106575419 ATCAGTACAGAGTTTCAGTTTGG + Intergenic
1058743905 9:107970994-107971016 AGGAATACCAAGTTTTACCTTGG - Intergenic
1058912065 9:109530200-109530222 ATGGGTACAGAATTTTAGTTTGG - Intergenic
1058970989 9:110082819-110082841 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1059109910 9:111546802-111546824 AGGAGTACAGAGTTTCAGTTTGG - Intronic
1059182053 9:112225433-112225455 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1059621371 9:116009349-116009371 ATGGGTACAGAGTTTCAACTGGG - Intergenic
1060099035 9:120821627-120821649 ATGGATACAGAGTTTCAGTTTGG - Intronic
1060131598 9:121105389-121105411 AAGAATTCAGAGTTTTATTTAGG + Intronic
1060298440 9:122359313-122359335 ATGAATGCAAAGTTTCAGTTAGG - Intergenic
1060439646 9:123626833-123626855 AAGAAAACAGAGTTCTAGATGGG + Intronic
1061662581 9:132139955-132139977 ATGGATACAGAGTTTTACCTTGG - Intergenic
1062322893 9:135998978-135999000 ATGACCACAGAGTTGGAGCTTGG - Intergenic
1062667676 9:137685220-137685242 ATGGATACAGAGTTTCTGCTTGG - Intronic
1062674955 9:137736905-137736927 ATATATACAGAGATTTGGCTGGG + Intronic
1062725223 9:138069282-138069304 ATCAAAATAGAGTTTTAGCAAGG + Intronic
1062728521 9:138094287-138094309 ATGGATACAGAGTTTCAGTTTGG + Intronic
1185871135 X:3665874-3665896 ATGAGGACAGAGTTTCAGTTGGG + Intronic
1185925450 X:4140823-4140845 ATGAGGACAGAGTTTCAGTTTGG - Intergenic
1185981136 X:4780143-4780165 GTGAATACACAGTTGAAGCTTGG + Intergenic
1186031449 X:5373570-5373592 ATGGATACAGAGTTTCAGCTGGG - Intergenic
1186344682 X:8679667-8679689 ATGAGTATGGAGTTTTAGTTTGG + Intronic
1186439300 X:9571695-9571717 ATGAGGACAGAGTTTCAGCTTGG - Intronic
1186541092 X:10401145-10401167 ATGAATACAGAGTTTCAGTTTGG - Intergenic
1187106337 X:16246272-16246294 ATGGATACAGAGTTTTGGCTTGG + Intergenic
1187367604 X:18677342-18677364 ATGACCACAGAATTTGAGCTGGG - Intronic
1187671274 X:21668134-21668156 ATGGATACAGAGTTTCTGTTTGG - Intergenic
1187891543 X:23940701-23940723 ATGACAACAGAATTTTAGTTGGG - Intergenic
1188202278 X:27305937-27305959 ATGAATACAGGGTTTGAGCTGGG - Intergenic
1188519019 X:31017110-31017132 ATGAATACAGAGGTAGAGCTAGG + Intergenic
1188952539 X:36393952-36393974 CTGGGTACAGAGTTTCAGCTTGG - Intergenic
1189015755 X:37094868-37094890 GTGTATACACAGATTTAGCTAGG - Intergenic
1189393600 X:40600117-40600139 AGGAGTACAGAGTTTCAGTTGGG - Intronic
1191259429 X:58298581-58298603 ATAAAAACAAAGTTTTAACTCGG - Intergenic
1192268073 X:69554030-69554052 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1192331710 X:70180660-70180682 ATGGATACAGAGTTTCAGTTTGG - Intronic
1192378537 X:70589045-70589067 ATGGATACAGAGTTTCTGTTTGG + Intronic
1192413608 X:70957153-70957175 ATGGATACAAAGTTTCAGTTGGG + Intergenic
1193131015 X:77919889-77919911 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1193183028 X:78481109-78481131 ATGAATACAGAGTTTCTGTTTGG + Intergenic
1193220113 X:78914175-78914197 ATGGATACAGAATTTCAGTTTGG - Intergenic
1193242517 X:79187820-79187842 ATGGATACAAAGTTTCAGTTTGG - Intergenic
1193252614 X:79309578-79309600 ATGGATACAGAGGTTTGTCTGGG - Intergenic
1193302773 X:79911523-79911545 ATGAATATGGAGTTTCAGCTTGG - Intergenic
1193730960 X:85102330-85102352 ATGATTACAGAGTTTCAGCTGGG + Intronic
1193794993 X:85863250-85863272 AAAAATACAAAATTTTAGCTGGG - Exonic
1195199171 X:102531192-102531214 TTGAATACAGAATTCTAGGTTGG - Intergenic
1195401019 X:104461445-104461467 ATGAGTAAGGAGTTTCAGCTTGG - Intergenic
1195635607 X:107111901-107111923 ATAAGTACAGAGTTTCAGTTTGG + Intronic
1195677588 X:107519097-107519119 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1195710500 X:107769515-107769537 ATGGGTACAGAGTTTTTGTTTGG + Intronic
1196236737 X:113290387-113290409 ATGAGTATAGAGTTTTTGTTTGG - Intergenic
1196290175 X:113930581-113930603 ATGAATAGAAAGTTTTAGTTTGG - Intergenic
1196355111 X:114782184-114782206 CTAAATACAGAATTTTAACTTGG - Intronic
1196507545 X:116465245-116465267 ATAAATATAGAGTTTCAGTTGGG - Intergenic
1197185701 X:123584759-123584781 ATGAATACAGAGTTTTACTTTGG + Intergenic
1197231083 X:124004313-124004335 ATGGGTATAGAGTTTCAGCTGGG - Intronic
1197663607 X:129199714-129199736 ATGTGTACAGAGTTTTAGTTGGG + Intergenic
1197733325 X:129830609-129830631 TTGAAAACAGAGTTTTCACTTGG + Intronic
1197982497 X:132231563-132231585 ATTAATACAGACTTATATCTAGG - Intergenic
1198231055 X:134689984-134690006 ATGAAGACAGAGTTTCAGTTGGG - Intronic
1198444520 X:136698634-136698656 ATGAATACAGAATTCTTGGTTGG - Intronic
1198776048 X:140179859-140179881 ATGAATACAATGTTTCAGGTAGG - Intergenic
1198813775 X:140564440-140564462 ATGGATATAGAATTTTAGTTTGG - Intergenic
1199268501 X:145855772-145855794 ATGAGTACAGAGATTCAGTTTGG + Intergenic
1199287879 X:146074096-146074118 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
1199387390 X:147238746-147238768 ATGGTTACAGAGGTTTAGTTTGG + Intergenic
1199440446 X:147862077-147862099 ATGGGTACAGAGTTTCAGTTGGG + Intergenic
1199725400 X:150575053-150575075 ATGACTACAGGGTTTTTTCTCGG + Intronic
1200289009 X:154854038-154854060 ATGAGTACAGAGTTTCTGTTTGG - Intronic
1200792919 Y:7315408-7315430 ATGAGGACAGAGTTTCAGTTGGG - Intergenic
1201240067 Y:11950309-11950331 ATGGATGCAGAATTATAGCTTGG - Intergenic
1201335609 Y:12877930-12877952 ATGTGTACAGAGTTTCAGTTTGG + Intergenic
1202298601 Y:23386519-23386541 ATGGATACAGAGTTTCAGTTTGG - Intergenic
1202572207 Y:26284080-26284102 ATGGATACAGAGTTTCAGTTTGG + Intergenic
1202587739 Y:26449649-26449671 ATGAAAATAGATTTTCAGCTGGG + Intergenic