ID: 1065419143

View in Genome Browser
Species Human (GRCh38)
Location 10:25522283-25522305
Sequence CCAAGCACTGGGAGGGTAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 152}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065419143_1065419153 23 Left 1065419143 10:25522283-25522305 CCCGTTACCCTCCCAGTGCTTGG 0: 1
1: 0
2: 0
3: 10
4: 152
Right 1065419153 10:25522329-25522351 CGCCTGCTTTTAAAAAGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065419143 Original CRISPR CCAAGCACTGGGAGGGTAAC GGG (reversed) Intronic
901229911 1:7635997-7636019 CCAGGCCCTGGGATGGAAACCGG + Intronic
905957279 1:42008850-42008872 CCAATCACTGTAAGGGTAATAGG - Intronic
908195578 1:61742989-61743011 CCCAGCTCTGGGAGCGAAACAGG - Intronic
913396795 1:118380338-118380360 CCAAGCTCTGGGAGGTCAGCTGG + Intergenic
915326870 1:155085276-155085298 TCAAGCGCTGGGAGTGCAACCGG + Exonic
915489929 1:156245260-156245282 CCAAGCACAGCGATGGTGACCGG - Intronic
915708729 1:157872639-157872661 CCAAGCACTGGGATTATAAGGGG + Intronic
915725254 1:158012759-158012781 CCATGCACTAGGCGGGTAATGGG - Intronic
917489125 1:175482838-175482860 CAAAGCCCAGGGAGGGTGACAGG - Intronic
918767915 1:188512666-188512688 CCAAGGGCTGGGATGGTAAAAGG - Intergenic
919570581 1:199243110-199243132 ACAAGCCCTGGCAGGGGAACGGG - Intergenic
919977527 1:202622635-202622657 ACAAGCGCAGGGAGGCTAACAGG - Intronic
921153426 1:212419395-212419417 CCAGCCAATGGAAGGGTAACAGG - Intergenic
922695541 1:227729177-227729199 GCCTGCAGTGGGAGGGTAACTGG + Intronic
923278839 1:232421969-232421991 CCAAGCATTGGCAGGCTCACAGG - Intronic
923313622 1:232758708-232758730 CCAAACACAGGGAGAGTAACAGG - Intergenic
923756456 1:236795444-236795466 CCAAGGACTGGCCGGGTACCCGG + Exonic
923842870 1:237692923-237692945 CCAGGCACTGAGAGTGCAACAGG - Intronic
1063244226 10:4201906-4201928 CCAAGCACTGGGGGATTAAAGGG + Intergenic
1065191208 10:23210679-23210701 CAAAGTACTGGGAGGATTACAGG + Intronic
1065419143 10:25522283-25522305 CCAAGCACTGGGAGGGTAACGGG - Intronic
1068827727 10:61458132-61458154 CCAAGGACTGGGCTGGTTACAGG + Intergenic
1071742490 10:88375937-88375959 ACAAGCAATGGGAGGATAAGGGG + Intronic
1071790857 10:88952723-88952745 CCAAGCACTGTCAGGGTAAGTGG - Intronic
1074100644 10:110352280-110352302 CCAAGCACTGGGCTGGGCACTGG + Intergenic
1076991874 11:279818-279840 CCGAGCCCTGGAAGGGAAACTGG - Exonic
1077489233 11:2852838-2852860 CCAGGCACTGGCTGGGTAATAGG + Intergenic
1078318222 11:10309084-10309106 CCAGGCACTGAGAAGGTACCAGG + Intronic
1084597195 11:70123876-70123898 CCAAAGCCTGGGGGGGTAACAGG + Intronic
1084838610 11:71826450-71826472 CCAAGCACTGAGATGTGAACTGG - Intergenic
1085402916 11:76245277-76245299 CACAGCTCTGGGAGGGGAACAGG - Intergenic
1087814212 11:102640851-102640873 CCAGGAACTGTGAGGGTAACGGG - Intergenic
1090443963 11:126747793-126747815 CCAAGCAGAGGGAGGGGAACAGG - Intronic
1091495833 12:972175-972197 CCAAGCACTAGGGGTGAAACAGG + Intronic
1092400079 12:8167643-8167665 CCAAGCACTGAGATGTGAACTGG + Intronic
1096254303 12:50053553-50053575 CCACGGACTGAGAGGGAAACAGG - Intergenic
1099173762 12:79397101-79397123 CCCAGCACTGGGAGAGTGAAAGG + Intronic
1100427108 12:94497652-94497674 ACAAGCTATGGGAGGGTAAGGGG + Intergenic
1106196471 13:27498282-27498304 CCAAGGACAGGAAGGGAAACAGG - Intergenic
1106435540 13:29720448-29720470 CCAAGCTCTGGCAGGGGAAGGGG + Intergenic
1106485612 13:30169693-30169715 CCAAGGACTGGGAGATTTACTGG + Intergenic
1106674561 13:31944741-31944763 CCAGGCACTGGGAAGGGAAAAGG + Intergenic
1108592270 13:51922657-51922679 CCAACCTCTGGGACGGTAAGAGG - Intergenic
1110313174 13:74074509-74074531 CCAAGCATTGGAATGGTACCTGG - Intronic
1112673039 13:101663471-101663493 CCAAGCACTGTGATGGCAGCTGG - Intronic
1112786094 13:102953246-102953268 CAAAGCACTGGGTAGGTAGCGGG + Intergenic
1114571635 14:23673299-23673321 CCAAGCACAGGGAGGACAAGGGG + Intergenic
1115907634 14:38218226-38218248 CCCAGAAATGGGAGGGTAGCAGG + Intergenic
1117875241 14:60245420-60245442 CCAAGCACTGTGTGGGACACTGG - Intergenic
1118140852 14:63080580-63080602 CAAAGCACTGGGATTGTACCCGG - Intronic
1121013395 14:90534652-90534674 CCGAGCGCTGGGAGGGTATGGGG + Exonic
1121488854 14:94343580-94343602 CCCAGCACTGGGAGGGTTAGGGG + Intergenic
1121645825 14:95516588-95516610 CCACGCTCCGGGAGGGTAAGTGG - Intronic
1121732901 14:96198586-96198608 CCAAGCCCTGGGTGAGGAACTGG + Intergenic
1122594309 14:102878835-102878857 CCCAGAACTGGGAGGGTGAGAGG + Intronic
1124493184 15:30171008-30171030 ACAAGCGCAGGGAGGCTAACAGG - Intergenic
1124750350 15:32367317-32367339 ACAAGCGCAGGGAGGCTAACAGG + Intergenic
1125518247 15:40334767-40334789 CCAGGCCCTGGGGGGGTGACGGG + Exonic
1125564803 15:40668658-40668680 CCAGTGACTGGGAGGGTAATGGG - Intergenic
1127804298 15:62504766-62504788 CTAAGTGCTGAGAGGGTAACAGG + Intronic
1131418942 15:92287409-92287431 GAAAGCACTGTGAGGGAAACAGG - Intergenic
1131927525 15:97401921-97401943 CAAAGCAAGGGGAGGGTAGCAGG + Intergenic
1134816555 16:17210658-17210680 CCCAGCACTGGGAGGCTGAAGGG - Intronic
1138267492 16:55670251-55670273 CCAAGCACTGGTTGGAGAACTGG + Intronic
1141299484 16:82800485-82800507 CCACATACTGGGAGGTTAACGGG - Intronic
1144844278 17:18208028-18208050 CCAAAGACTGGGATGGTCACTGG + Intronic
1148271822 17:46267273-46267295 CCAGGGACTGGGAGAGGAACTGG + Intergenic
1148282230 17:46357482-46357504 CTAAGCACTGGGAGCGTACTTGG + Intronic
1148304448 17:46575407-46575429 CTAAGCACTGGGAGCGTACTTGG + Intronic
1149291087 17:55218269-55218291 CCAAGCACTGGGCTTGGAACTGG + Intergenic
1155692390 18:28641473-28641495 CCAACCAGTGGCAGAGTAACTGG - Intergenic
1158622014 18:59041054-59041076 CCAAGCCCTGGGAGGGACACTGG + Intergenic
1160158877 18:76455975-76455997 CCAGTCTCTGGGAGGGGAACAGG - Intronic
1160875793 19:1295730-1295752 TCAAGCGCTGGGAGTGCAACCGG + Exonic
1161220769 19:3117041-3117063 CCAAGCTCTGGGATGGTTCCCGG + Intronic
1161694439 19:5758150-5758172 CCCAGCCCGGGGAGGGTAGCCGG + Intronic
1162734819 19:12740802-12740824 TCAGGGACTGGGAGGGAAACAGG + Intronic
1163378209 19:16947264-16947286 CCAGGCACTGGGAGGGGGTCTGG - Intronic
1167311644 19:48740602-48740624 CCCAGCACTGGGTGGGGGACAGG + Exonic
929805195 2:45138766-45138788 CCAAGAACGGGGAGGGGAAGAGG + Intergenic
934937241 2:98474278-98474300 CCAAGCACTGGGAAGGCTGCGGG - Intronic
938139196 2:128782616-128782638 ACATGCAGTGGGAGGGTGACGGG + Intergenic
938463849 2:131514297-131514319 CTTAGCACTGGGAGGGCAAGTGG - Intergenic
939593339 2:144093821-144093843 CCAAGCACTGGGTAGGGTACTGG - Intronic
941718264 2:168786555-168786577 CCAAGCACTGGTAGGGCACTGGG + Intronic
947573944 2:231257615-231257637 CCAGTCACAGGGAGGGTAGCAGG - Intronic
947947865 2:234121924-234121946 CCAAACACTGGAAGGTTAATGGG - Intergenic
1170566803 20:17612176-17612198 CCAGGCACAGGGCGGGAAACGGG + Intergenic
1173911421 20:46673760-46673782 CCAGGCACTGGGAGTGTGGCAGG - Intronic
1174096828 20:48096424-48096446 CCAGGCACTGGGAGGGAGGCTGG - Intergenic
1175200066 20:57270613-57270635 CCCAGCACTGGGAGGCCAGCAGG - Intergenic
1175847768 20:62067564-62067586 CAAAGCACAGGCAGGCTAACTGG + Intergenic
1177086746 21:16714397-16714419 CCAATCACTGGCAGGGGAAATGG + Intergenic
1178623696 21:34198366-34198388 CCAGGCACGGGGAGGGTAGTAGG + Intergenic
1179829106 21:43985014-43985036 CCTGGCTCTGGGTGGGTAACAGG - Exonic
1180861751 22:19087170-19087192 CCAAGCACTGGGAAGCCCACTGG + Intronic
1181696824 22:24597229-24597251 CCCAACACTGGGAGGCTGACAGG - Intronic
1182593505 22:31399998-31400020 CCAAACACTGGGAGGGGGAACGG - Intronic
1184150826 22:42637543-42637565 CCAGGCACTGGGAAGGTCACTGG + Intronic
951707134 3:25554635-25554657 CCCGGCACTGTGAGGGTTACTGG - Intronic
951920151 3:27845677-27845699 CCTAGGACTGGCAGGGTCACAGG + Intergenic
952584265 3:34872512-34872534 ACAGGCACTGGGAGGGCTACGGG + Intergenic
954645076 3:52126286-52126308 CCAAGTTCTGGGAGGGAAAAGGG + Intronic
961208576 3:125107734-125107756 CCAGGCAAGGAGAGGGTAACAGG - Exonic
962481909 3:135805240-135805262 TAAAGCACTGGGAGGTTAAAGGG + Intergenic
964551131 3:157886012-157886034 TCCATCACTGGGAAGGTAACAGG + Intergenic
969780026 4:9393936-9393958 CCAAGCACTGAGATGTGAACTGG - Intergenic
971788008 4:31129960-31129982 CTAATCACTAGGAGGGAAACAGG + Intronic
976125164 4:81826664-81826686 CCAAGCACTGGGCTAGTAATGGG - Intronic
976139009 4:81970984-81971006 CCAAGCTCTTGTAGGGTGACCGG + Intronic
976219285 4:82742932-82742954 CCCAGGACTGGGTGGGTAATTGG - Intronic
976282157 4:83335795-83335817 CCAAGCTCTGAGACAGTAACTGG + Intergenic
976399757 4:84594303-84594325 GCAAGTTCTGGGAGGGTAAGGGG + Intronic
980115843 4:128678412-128678434 TCAAGCAATGGAAGGGTAAGGGG - Intergenic
980115849 4:128678439-128678461 TCAAGCAATGGAAGGGTAAGGGG - Intergenic
985584891 5:725623-725645 TCAAGCCCTGGGAGGGAGACAGG + Intronic
985598395 5:809937-809959 TCAAGCCCTGGGAGGGAGACAGG + Intronic
986628160 5:9742213-9742235 CAAAACACTCGGAGAGTAACAGG - Intergenic
988835546 5:35028846-35028868 GCAAGCACTGGGATGGTAGGTGG - Intronic
995357665 5:111257997-111258019 CCTAGCACGGGGAGGGTGTCGGG + Intronic
996615143 5:125432432-125432454 GCAAGGACTGGCAGGGTAAAGGG + Intergenic
999200501 5:149812895-149812917 CCACCCACTGGGAGGGGAATGGG + Intronic
1001075025 5:168620104-168620126 CCACGTGCTGGGAGGGTACCGGG - Intergenic
1001411857 5:171517952-171517974 CCAAGCTCTGGGAAAGCAACAGG + Intergenic
1002430075 5:179198366-179198388 CCAAGCACTGTGAGGCTAGGAGG - Intronic
1003114891 6:3277175-3277197 TCAAGAACTGGGAGGCGAACAGG + Intronic
1011663120 6:89611055-89611077 CCAGGCACAGGGAGGATTACAGG - Intronic
1013627417 6:111951606-111951628 ACCTGCACTGGGTGGGTAACAGG - Intergenic
1018232894 6:161692654-161692676 CCCAGCACTGGGAGGCTGAGGGG + Intronic
1019046804 6:169155782-169155804 ACATGCACTAGGAGGGTAATTGG + Intergenic
1019702674 7:2481565-2481587 CCAGGCACTAGGTGGGCAACTGG - Intergenic
1023837786 7:44078650-44078672 CCATGCACGGGGAGGCAAACAGG - Intronic
1024930453 7:54663104-54663126 CCAAGCACTGAGAGGGAAAAGGG + Intergenic
1025730804 7:64105386-64105408 GCAAATACTGGGAGGGTAATGGG + Intronic
1026888760 7:73970035-73970057 CCAAGCACTAGGAGGGTCCTCGG + Intergenic
1028496313 7:91464703-91464725 CCAGGCACTGGCAGGGTGAACGG - Intergenic
1031180275 7:118405133-118405155 CCAGAGACTGGGAGGGTAATAGG - Intergenic
1035319162 7:158017411-158017433 CCAAGCACTGGGATGGAGCCTGG - Intronic
1036277450 8:7367911-7367933 CCAAGCACTGAGATGTGAACTGG - Intronic
1036552418 8:9827006-9827028 CCAGGCACTGTGAGGGCAAGAGG - Intergenic
1036839226 8:12103190-12103212 CCAAGCACTGAGATGTGAACTGG + Intergenic
1036861015 8:12349433-12349455 CCAAGCACTGAGATGTGAACTGG + Intergenic
1038263550 8:26018967-26018989 CCAAACACTGGGAAGGTATTAGG + Intronic
1039957682 8:42219776-42219798 CAAAGCACTGGGATTGTAGCCGG - Intergenic
1041732627 8:61077778-61077800 CCCAGCACTGGGAGGAGCACAGG + Intronic
1044434869 8:92150472-92150494 CTAAGCACTGGGAGTATAGCAGG + Intergenic
1044611343 8:94095343-94095365 CCAATCACTGGGAAGGAGACAGG - Intergenic
1044743421 8:95350363-95350385 GCAAGCACTGGTAGGGGAAGAGG + Intergenic
1046190279 8:110786237-110786259 CCATGTCCTGGGAGGGAAACTGG - Intergenic
1049470007 8:142771013-142771035 CCAGGCACAGGGAGGGAGACAGG - Intronic
1056339395 9:85610295-85610317 CCAAGTAATGGGGGGGTAAGAGG + Intronic
1057134831 9:92680413-92680435 CCAGGCACTGGGTGGGTTGCAGG + Intergenic
1057600727 9:96454864-96454886 CCCAGCACTGGGAGGCTAGGCGG + Intronic
1058485839 9:105442715-105442737 TCAGGCACTGGAAGGGTACCTGG - Intergenic
1058874302 9:109229776-109229798 CCAAGGACTGGGAGAATAAATGG - Intronic
1059479241 9:114575629-114575651 GCAAGCAATGGGAGGGCAGCAGG - Intergenic
1060846400 9:126840978-126841000 CCAAGGAATGGGCGGGTAAAAGG - Intergenic
1060846541 9:126842095-126842117 CCAAGGAATGGGCGGGTAAAAGG + Intergenic
1060958826 9:127664561-127664583 CCAGGCACTGGGACAGCAACCGG - Intronic
1188911572 X:35854419-35854441 CCAACCACTGAGAGGCTGACTGG - Intergenic
1191223195 X:58013810-58013832 CCAAGCTCTGGGCTGGTAATGGG + Intergenic
1194518446 X:94888357-94888379 CCTAGCTATGGGAGGGTAACCGG - Intergenic
1198448346 X:136740752-136740774 CCAAGCACTGCGAGGGGACCTGG - Intronic