ID: 1065421963

View in Genome Browser
Species Human (GRCh38)
Location 10:25554944-25554966
Sequence TCAGTGGCTTGCCAGTGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 170}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065421963_1065421967 20 Left 1065421963 10:25554944-25554966 CCACCTCACTGGCAAGCCACTGA 0: 1
1: 0
2: 0
3: 14
4: 170
Right 1065421967 10:25554987-25555009 GCTGAAACTATTTGAGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065421963 Original CRISPR TCAGTGGCTTGCCAGTGAGG TGG (reversed) Intronic
901012687 1:6210328-6210350 TCAGTGCCTGGCCGGGGAGGAGG - Intronic
901332210 1:8419001-8419023 ACAGTGGCTTGACAGAGAAGAGG + Intronic
901366293 1:8752117-8752139 TAAGTAACTTGCCAGTGAAGTGG + Intronic
902843386 1:19090068-19090090 TCAGAGGTTTGCGAGTAAGGTGG - Intronic
904260780 1:29286545-29286567 TCAGGGGCTTGCCATTCTGGGGG - Intronic
906115194 1:43352158-43352180 GCAGTGGATTGGCAGGGAGGAGG - Intronic
906179055 1:43802611-43802633 TCAGTGGCAGGCCAGCCAGGTGG - Intronic
908921792 1:69203184-69203206 TCAGTGGCTTTGCAGTCATGGGG + Intergenic
911568728 1:99496481-99496503 TCTGTGATTTGCCAGTGAGTTGG - Intergenic
920431636 1:205922568-205922590 TCAGTGGCTTCCCTGGGAGATGG + Intronic
923300116 1:232632355-232632377 TCAGTGGGTTGTCATTGAGGTGG + Intergenic
924648460 1:245902091-245902113 TCAGTGGCATTCCAGGGATGTGG - Intronic
1065421963 10:25554944-25554966 TCAGTGGCTTGCCAGTGAGGTGG - Intronic
1066277358 10:33881949-33881971 TCAGTGACTTGCATGTGAGTTGG + Intergenic
1066336656 10:34484946-34484968 GGAGTGGGTTGCCAATGAGGAGG - Intronic
1067544131 10:47179726-47179748 TCTCTGGCTGGCCAGTGTGGTGG + Intergenic
1069691676 10:70357664-70357686 TTACTGGCTTGCCAGGAAGGAGG - Intronic
1069756179 10:70775633-70775655 ACCTTGGCTTCCCAGTGAGGGGG - Intronic
1069812960 10:71175921-71175943 TCCATGCCTTCCCAGTGAGGGGG + Intergenic
1070599654 10:77856839-77856861 TCACTTGCTGGTCAGTGAGGAGG + Exonic
1071262307 10:83931807-83931829 CCTGTGCCATGCCAGTGAGGAGG - Intergenic
1073082387 10:100868365-100868387 TCAGGGGCTTGCCAATGCTGAGG - Intergenic
1074289873 10:112130415-112130437 TCAGGGACTTGCAAGGGAGGGGG + Intergenic
1076622377 10:131799847-131799869 TCTGTGGCTTGATTGTGAGGAGG + Intergenic
1076645737 10:131952948-131952970 TCAGTGACTTGCGAGTGTGCGGG + Intronic
1079102981 11:17552932-17552954 CCACCGGCTTGCCAGGGAGGGGG + Intronic
1080267122 11:30413182-30413204 TCAGTGGCTTCCTGGTTAGGTGG - Intronic
1080639215 11:34148990-34149012 TCAGGGGATTGCCCCTGAGGGGG + Intergenic
1081979583 11:47258015-47258037 TCGGTGGCCAGCCAGTGAGCTGG - Exonic
1084031413 11:66482969-66482991 TCAGTGGGTTACCTCTGAGGAGG - Intronic
1085510843 11:77087325-77087347 CCAGCTGCTTGCCAGTGAGAGGG + Intronic
1090251902 11:125257409-125257431 GCAGGGGCTGGCCAGTGAGCTGG + Intronic
1090457242 11:126860721-126860743 TGGGTGGCAGGCCAGTGAGGAGG + Intronic
1096705741 12:53420866-53420888 GCAGGGCCTTGCCAGTGAGATGG - Intergenic
1098367645 12:69721512-69721534 TCAGAGGCTTAGCAGTGAGTTGG - Intergenic
1098850879 12:75594444-75594466 TCAGTGGCTTGCAAGCAAGAGGG - Intergenic
1100818942 12:98413105-98413127 TCAGTGGCTTGGGAGTGATTTGG - Intergenic
1103014436 12:117482766-117482788 ACAGTGGCTTGTCCCTGAGGTGG - Intronic
1103700389 12:122846141-122846163 ACAGCTGCTTGCCAGTGAGCTGG + Intronic
1103704769 12:122865562-122865584 TCACTGCCATGCCAGTCAGGCGG - Exonic
1104207411 12:126652988-126653010 TTCATGGCTTGCCAGTGAAGTGG + Intergenic
1104491977 12:129202100-129202122 TCAGTGGATTTCCTGAGAGGAGG + Intronic
1106584912 13:31048530-31048552 TCAGTGGAGTGGCAGTGGGGTGG + Intergenic
1107261385 13:38495388-38495410 TCCCTAGCTTGGCAGTGAGGTGG - Intergenic
1108465778 13:50714155-50714177 TCAGTGGCTCACCAGTAAGCAGG - Intronic
1108987073 13:56605201-56605223 TCAGTACCTTGCCAGCCAGGTGG + Intergenic
1110566708 13:76964779-76964801 TGTGTGGCCTGCCAGTGAAGAGG - Intergenic
1113063923 13:106355230-106355252 TCAGCAGTTGGCCAGTGAGGCGG - Intergenic
1115760816 14:36578610-36578632 TCAGCTGCTTGCCAGTGGAGTGG - Intergenic
1117941720 14:60973963-60973985 ACAGTTGCTTGCCTGTGAGTTGG + Exonic
1119485797 14:74985559-74985581 TGAGTGGCTTGCCACTGGTGGGG - Intergenic
1119679922 14:76584647-76584669 CCAGTGGCTGGCCAGGGTGGCGG + Intergenic
1122383953 14:101331328-101331350 AAAGTGGCTTGACAGAGAGGAGG + Intergenic
1122423639 14:101592693-101592715 TCAGTGGCTTGATAGTAAGGTGG - Intergenic
1122509104 14:102251419-102251441 TTAGTGGCTTGGGAGTGAGACGG + Intronic
1130017806 15:80201277-80201299 GCAGTGGTGTGGCAGTGAGGGGG - Intergenic
1131021424 15:89102507-89102529 GCAGTGGCTTGCAAATGAAGAGG - Intronic
1132685834 16:1161739-1161761 TCGGTGGGTGGCCAGTGCGGCGG + Intronic
1134378850 16:13705062-13705084 TCAATAGCTTGCAAGTGAAGAGG + Intergenic
1135030421 16:19033725-19033747 TCAGAGGCTTGCAACTGAGATGG + Intronic
1135138964 16:19905735-19905757 TCAGAGGCATGGCAGTGAGGAGG - Intergenic
1136127318 16:28193549-28193571 CCAGTGCCTCGCCAGTGGGGTGG - Intronic
1139114855 16:63937664-63937686 TCAGTGGGTAGCCAGTAGGGCGG + Intergenic
1141648448 16:85379675-85379697 TCAGTGGCCTGGCAGGGAGCAGG - Intergenic
1142410070 16:89911468-89911490 CCAGTGGCTTGTGGGTGAGGTGG + Intergenic
1142431843 16:90032882-90032904 GCAGGAGCTGGCCAGTGAGGTGG + Exonic
1151444329 17:74153350-74153372 TCAGTGGGTTTCCTGTGAGTTGG - Intergenic
1151554011 17:74837526-74837548 TCAGCGGCTTGGCAGTGACATGG + Exonic
1154466026 18:14643157-14643179 CCTGTGGCATGCCAGTGGGGGGG + Intergenic
1157046588 18:44107516-44107538 TCTGTGGCCATCCAGTGAGGAGG - Intergenic
1157441572 18:47715776-47715798 TCATTGGCTTGACAGTGGGGGGG + Intergenic
1157486323 18:48090004-48090026 TCCGTGGCAGGGCAGTGAGGTGG + Intronic
1157809018 18:50679915-50679937 TCAGTGAGTCTCCAGTGAGGAGG - Intronic
1159345793 18:67201324-67201346 TCAGTGGACTGCCAGTGTGACGG + Intergenic
1161951518 19:7470400-7470422 TCAGTGGTTTGCTAGGGAAGAGG - Intronic
1163232234 19:16012691-16012713 CCAGAGTCTTGTCAGTGAGGGGG + Intergenic
1166859425 19:45801267-45801289 ACAGTGGCTTCCCAGTCTGGAGG - Intronic
1167294640 19:48642696-48642718 TGAGAGGCAGGCCAGTGAGGAGG + Intronic
1168692800 19:58386849-58386871 TCAGGCGCGTGCCGGTGAGGCGG + Intronic
926139248 2:10358662-10358684 TCAGTGGCCTGCCAGCGTGCCGG - Intronic
926989077 2:18657696-18657718 TCAGTGGCTTGCCTCTGGTGTGG + Intergenic
929242642 2:39667108-39667130 TCAGTGCCTGGACAGCGAGGAGG - Intronic
931771382 2:65500976-65500998 TCAGTGACTCGCCTGTGATGTGG + Intergenic
939122126 2:138129787-138129809 TCAGTGACTTGCCAGTGGCCAGG - Intergenic
939444062 2:142286563-142286585 CCAGTGGCTTGGCAGGGAGTTGG + Intergenic
941092439 2:161193691-161193713 TCATTTCCTTGCCAGTGAGAAGG + Intronic
941216685 2:162718985-162719007 TCAGTGGATTGGAAGAGAGGTGG - Intronic
943046207 2:182865363-182865385 TCTGTGGCTTGCCATAGAGCTGG - Intronic
943378792 2:187117296-187117318 TCAGTGGATTGCCAATGCAGTGG - Intergenic
945473468 2:210254109-210254131 TAAGTGTGTCGCCAGTGAGGGGG + Intergenic
948036460 2:234862246-234862268 ACAGTGGCTTGCGGGGGAGGTGG - Intergenic
948695745 2:239732281-239732303 TCACTGGCCTGGCAGGGAGGAGG - Intergenic
948894751 2:240922855-240922877 TGAGTGGCTGGGCAGTGTGGGGG + Intronic
1168958494 20:1851473-1851495 TCAGTGGCTCACCAGTGCTGTGG - Intergenic
1172027585 20:31959578-31959600 TCTATGGCCTGCCAGTGTGGTGG + Intergenic
1173026825 20:39315337-39315359 TCAGTGACTTCTTAGTGAGGGGG + Intergenic
1174005640 20:47408575-47408597 GCAGTGGCTTTCCAGTGGAGAGG + Intergenic
1176382022 21:6118389-6118411 TCAGTGGTTTGGAGGTGAGGGGG + Exonic
1176808560 21:13515439-13515461 CCTGTGGCATGCCAGTGGGGGGG - Intergenic
1179741450 21:43419850-43419872 TCAGTGGTTTGGAGGTGAGGGGG - Exonic
1180120131 21:45740304-45740326 GAAGTGACCTGCCAGTGAGGCGG - Intronic
1182434166 22:30319704-30319726 GCATTGACTTGCCAGTGGGGTGG + Intronic
1182990982 22:34767422-34767444 TATGTGGCTTGCCAGTGTTGGGG + Intergenic
1183127302 22:35795675-35795697 ACAGGGGCTTTCCAGTGAGGAGG + Intronic
1184981765 22:48100435-48100457 CCAGTGGCTGGACAGGGAGGGGG - Intergenic
950230846 3:11274540-11274562 TCACTGGAGTGCCAGTGTGGAGG + Intronic
954435555 3:50493996-50494018 TCAGGGGCTAGCCAGGGAAGTGG + Intronic
954922484 3:54203705-54203727 TCAGTGGCCTGCCTGTGTGCTGG + Intronic
955405834 3:58625138-58625160 TCAGTCACTTGCCAGAGTGGAGG - Intronic
957855915 3:85877902-85877924 TCAGTGGGTTTCCTGTGAGCAGG - Intronic
959486754 3:106935588-106935610 TAAGTGACTTGCCAAAGAGGAGG - Intergenic
959892037 3:111567811-111567833 TCAGAGGCTTGCCTGTGAGAAGG - Intronic
961146720 3:124599944-124599966 CCAGTGAATTCCCAGTGAGGTGG + Intronic
962234949 3:133699761-133699783 TGAGCGGCTTGTCAGTGAAGAGG - Intergenic
964500226 3:157340477-157340499 TCAATGGCCTGCCATTGATGAGG + Intronic
968428992 4:544173-544195 TCAGTGTCTGGCCATTGAAGAGG + Intergenic
968528074 4:1074604-1074626 TTAGAGTCTTGCCAGTGAGTAGG - Intronic
968581183 4:1396119-1396141 TCAGTGACTTGGCACTAAGGGGG + Intergenic
969624558 4:8295695-8295717 TCAATGAACTGCCAGTGAGGGGG - Intronic
970024077 4:11602887-11602909 TCTGTTGCTTGCCAGAAAGGTGG + Intergenic
976088416 4:81429871-81429893 TAAGTGGCCTGCCAGTGTGCTGG - Intronic
976833238 4:89339519-89339541 TCAGTGGCTTCCCAATGAACTGG + Intergenic
985228991 4:187794778-187794800 TGAGTGGATTGCCTGGGAGGTGG - Intergenic
985720895 5:1488153-1488175 TCAGGGCGTTTCCAGTGAGGTGG - Intronic
986107137 5:4670748-4670770 TTGATGGCTTGCCAGTGTGGAGG + Intergenic
986343308 5:6811270-6811292 TGAGTGGCTAGCCAGTGGGAAGG - Intergenic
987255628 5:16147868-16147890 GCAGTGGCTAGCCAGTGTGGAGG - Intronic
987381730 5:17291863-17291885 TCACTGGTTGGGCAGTGAGGTGG - Intergenic
990777237 5:59315830-59315852 TCAGTGACTTGCCAGTAATCTGG - Intronic
991068625 5:62452383-62452405 TCACTTAGTTGCCAGTGAGGAGG + Intronic
991989885 5:72327062-72327084 TGAGTGACTAGCCAGTGAGAAGG - Intronic
991998686 5:72414575-72414597 TCAGAAGCTTTCCAGTGAGATGG + Intergenic
993643456 5:90434285-90434307 GCAGTGCCTTGGCTGTGAGGTGG - Intergenic
998417809 5:141958310-141958332 TAAGTGGCCTGCCGCTGAGGAGG + Exonic
999314788 5:150576456-150576478 TCAGGGGCCTGTCTGTGAGGAGG + Intergenic
1000887892 5:166768246-166768268 TCAATGACTTGTCAGGGAGGGGG - Intergenic
1003304366 6:4913002-4913024 AGAGTGACTTGCCGGTGAGGTGG + Intronic
1004348983 6:14874471-14874493 TCAGTTGCTTGCCACTGAGTAGG - Intergenic
1006715681 6:36118498-36118520 TCAGTTGAGTGCCAGGGAGGTGG - Intergenic
1010462802 6:76132538-76132560 TCATTGGCTGGGGAGTGAGGAGG + Intergenic
1010750220 6:79609118-79609140 TCTGTTGCTTACCAATGAGGAGG - Intergenic
1016830016 6:148424762-148424784 TCAGTGGCCTGCAGGTGAAGGGG - Intronic
1017188394 6:151625733-151625755 CCAGTGGCTAGCCAGTGAAGGGG + Intergenic
1017245858 6:152223720-152223742 TGATTGGCTGGCCAGGGAGGCGG + Intronic
1018133721 6:160757581-160757603 ACGGTGGCTTCACAGTGAGGAGG - Intergenic
1018377932 6:163231284-163231306 TCAGTGGCATGGCAGTGAGTGGG - Intronic
1019463698 7:1174976-1174998 TCAGGGGCCTGGAAGTGAGGTGG - Intergenic
1019938900 7:4273821-4273843 ACAGTGGGTTGCCAGAGATGGGG - Intergenic
1021159610 7:17256049-17256071 TCACTGATTTGGCAGTGAGGAGG - Intergenic
1021695517 7:23272207-23272229 TCAGTGGTTTGCCAGTGCAGAGG - Intronic
1026408659 7:70095801-70095823 TCAGTGGTTTGCCATTTACGAGG + Intronic
1027058122 7:75064470-75064492 TCAGAGGCATGCCTGAGAGGGGG - Intronic
1028239256 7:88399279-88399301 TCATTGGCTTGCCATGGAGCTGG + Intergenic
1031365224 7:120892766-120892788 GAAGTACCTTGCCAGTGAGGGGG - Intergenic
1031447858 7:121876252-121876274 ACAGTGGCTTTCCTGTAAGGAGG + Intronic
1031839988 7:126726316-126726338 TCAGTGGCTTGCCTGCTAGATGG + Intronic
1033591619 7:142813214-142813236 AAAGAGGCTTGCCAGAGAGGAGG + Intergenic
1033591882 7:142815662-142815684 AAAGAGGCTTGCCAGAGAGGTGG - Intergenic
1034439779 7:151080758-151080780 TCGGTGGCTAGCCGATGAGGAGG - Exonic
1037609446 8:20464048-20464070 TGAGTGCCTTCTCAGTGAGGTGG + Intergenic
1039759386 8:40558260-40558282 TCAGTGGATTGCCAGCGGAGGGG + Intronic
1039933118 8:42013023-42013045 TCAGTGGTTTGCCAGGGTTGGGG + Intronic
1042839834 8:73112389-73112411 TCTGTGGCTTGCCGGGCAGGTGG - Intronic
1043162572 8:76864055-76864077 TCAGTGTCTTGCCTGTGATGTGG + Exonic
1044080217 8:87873753-87873775 TCGGTCGCTTGCCAAAGAGGAGG + Exonic
1044624522 8:94223771-94223793 CCAGTGGCCTGGGAGTGAGGGGG + Intergenic
1044748517 8:95394460-95394482 TCCTTGCTTTGCCAGTGAGGTGG + Intergenic
1047531799 8:125683719-125683741 TCAGTGAGTTGCCTTTGAGGAGG - Intergenic
1047916736 8:129591876-129591898 TCAGGGGCTGGTCAGTAAGGGGG - Intergenic
1049245442 8:141559962-141559984 TCAAGTGCTGGCCAGTGAGGTGG + Intergenic
1049442569 8:142616062-142616084 TCAGAGGGTTGGCAGGGAGGGGG - Intergenic
1049597673 8:143492248-143492270 TCAGTGGGTGGCCGGTGAGGAGG - Intronic
1051887028 9:21904145-21904167 TCAGTGGCCTGCCAGTGTGCTGG + Intronic
1052758988 9:32570253-32570275 TCAGTGGGTTGCAGGGGAGGAGG - Intronic
1052999732 9:34571361-34571383 GCAGTGGCCTGGCACTGAGGCGG - Intronic
1057024675 9:91725834-91725856 GCAGGGGCTGGCCAGCGAGGAGG - Intronic
1057802399 9:98198283-98198305 TCGGTGGTTTTCCAGAGAGGAGG + Intergenic
1059876141 9:118637235-118637257 TCAGTGGTTTGCCAGGGTTGGGG + Intergenic
1062074385 9:134576597-134576619 TCAGGCGCCTGCCAGGGAGGGGG - Intergenic
1187628456 X:21142372-21142394 TCAGTGGGGTTCCAGGGAGGTGG + Intergenic
1192226523 X:69231972-69231994 TCAGTGGCTTGCCTTTGCTGTGG + Intergenic
1194605818 X:95976430-95976452 ACAGTGGCTTGGCAGAGAGTAGG + Intergenic
1195538568 X:106036638-106036660 TCAGATGCTTGCCAATGAAGAGG + Exonic
1197148185 X:123191622-123191644 TCAGGGGCTGGTCAGTGAGTAGG - Intronic
1197271238 X:124426895-124426917 TCAGTGCCCTGCCACTGAGAGGG + Intronic