ID: 1065423790

View in Genome Browser
Species Human (GRCh38)
Location 10:25577600-25577622
Sequence GAGCAAAAATAGAATGAGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 409
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 379}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065423790 Original CRISPR GAGCAAAAATAGAATGAGCC CGG (reversed) Intronic
900267539 1:1766098-1766120 TAGCAAAAAAAAAATTAGCCGGG + Intronic
900676538 1:3890690-3890712 GTGCAGAAGCAGAATGAGCCAGG - Exonic
901562172 1:10081221-10081243 TACCAAAAATAAAATTAGCCAGG - Intronic
903134913 1:21302994-21303016 GGGCAGAAATAGCAGGAGCCTGG - Intronic
904357933 1:29953447-29953469 CTGCAGAAATAGAAAGAGCCTGG + Intergenic
904855354 1:33493676-33493698 GAGACAAAAGATAATGAGCCTGG - Intronic
905406469 1:37735712-37735734 CAGCAAGTATAGAAAGAGCCTGG - Intronic
906895767 1:49769516-49769538 AAGCAGAAAAAGAAAGAGCCAGG + Intronic
909771368 1:79426228-79426250 GAGCAAATAAAGAATGAACTAGG + Intergenic
909789187 1:79652452-79652474 GTGCAAAGATAGAATGAGAGAGG + Intergenic
910080419 1:83334910-83334932 TAGCAGAACTAGAATGGGCCAGG + Intergenic
910447093 1:87309762-87309784 TACCAAAAATACAATTAGCCAGG + Intergenic
910573339 1:88730387-88730409 GAGCAGAAAGAGAGAGAGCCTGG - Intronic
910996418 1:93109073-93109095 TAGTAAAAATAAAATGAGCAGGG - Intronic
911186114 1:94906577-94906599 TAGCAAAGATAGATGGAGCCAGG - Intronic
911285804 1:95991003-95991025 GGAGAAAAATAGAATGGGCCCGG + Intergenic
911812629 1:102303002-102303024 GAGCAAAACCAGCATGAACCAGG + Intergenic
911929753 1:103887005-103887027 GAACAAAAACACAATGTGCCAGG + Intergenic
913700674 1:121370844-121370866 AACCAAAACTAGAGTGAGCCAGG - Intronic
914041223 1:144051306-144051328 AACCAAAACTAGAGTGAGCCAGG - Intergenic
914986893 1:152467340-152467362 GAGAAAGGATAGAATGAGACAGG - Intergenic
915537061 1:156543165-156543187 GAGACAAAATAGAATGGGCTAGG + Intronic
917165597 1:172108927-172108949 GAACAAAAATAAAATAAGCTTGG + Intronic
918511641 1:185319000-185319022 AAGCAAAAATACAATGAGTGTGG - Intergenic
919251057 1:195056560-195056582 AAGCAAAAATAGAATTAGATAGG - Intergenic
920488091 1:206389577-206389599 AACCAAAACTAGAGTGAGCCAGG - Intronic
920780974 1:208990920-208990942 GAGCAACACAAGAAAGAGCCTGG + Intergenic
921678513 1:218004608-218004630 GAAAATAAATAGAATTAGCCAGG + Intergenic
1062954842 10:1533277-1533299 AAAAAAAAAAAGAATGAGCCAGG - Intronic
1063935108 10:11069537-11069559 TAGCAAAAACAGAATGCTCCAGG - Intronic
1064247872 10:13683603-13683625 GACAAAAAAAAGAATGAGACAGG + Intronic
1065042337 10:21710200-21710222 GAACAAAAATGGAATCACCCAGG - Intronic
1065423790 10:25577600-25577622 GAGCAAAAATAGAATGAGCCCGG - Intronic
1066007595 10:31160227-31160249 GAGAAAAAAAAGAATGAAGCTGG - Intergenic
1066594743 10:37037934-37037956 AAACAAAAAAAGAATTAGCCGGG - Intergenic
1068512022 10:57978752-57978774 GATAAAAAAAAGAATTAGCCAGG + Intergenic
1070377228 10:75844517-75844539 GAGCCAAGATGGAGTGAGCCCGG - Intronic
1071730896 10:88247408-88247430 CAGAAAAAATAGAATGAGTTCGG + Intergenic
1072464681 10:95652433-95652455 GAACAAAAATAGCATGGGGCCGG + Intronic
1073983053 10:109176807-109176829 GTCCAAAAATAGAAGGAACCTGG + Intergenic
1076503455 10:130955238-130955260 GAGCAAACGTCGAATGAGCCTGG - Intergenic
1077160300 11:1109621-1109643 GAGGGAAAGGAGAATGAGCCCGG - Intergenic
1078918915 11:15808616-15808638 GATCAAAAATCAAATGAACCAGG + Intergenic
1080165780 11:29234528-29234550 GAGTAAGAATAGAGTGAGACCGG - Intergenic
1080543208 11:33289282-33289304 AAGAAAAAAAATAATGAGCCAGG + Intronic
1083161853 11:60859174-60859196 GAGCACAAACAGCATAAGCCAGG - Intergenic
1083808941 11:65091728-65091750 GAACAAAAACAAAATTAGCCGGG + Intronic
1084607694 11:70182035-70182057 GTGCTATAATAGAATGAGCCGGG + Intronic
1085104416 11:73829923-73829945 CTACAAAAATATAATGAGCCGGG - Intronic
1086302448 11:85442271-85442293 GAGCAAAAGTAGAATTAGGAAGG + Intronic
1086857999 11:91889961-91889983 GAGCATAAATATTATGAGGCAGG - Intergenic
1087241541 11:95787392-95787414 CAACAAAAAAAAAATGAGCCGGG - Intronic
1087257453 11:95972321-95972343 GGGCAAAAATACAAGGAGCCAGG - Intergenic
1087650544 11:100861900-100861922 GAGAAAGAATAGAGTGAGACGGG + Intronic
1088064031 11:105693846-105693868 GAGTAGCCATAGAATGAGCCTGG - Intronic
1088255622 11:107900866-107900888 GAGCAAACATAGACTAAGCAGGG + Intronic
1088328417 11:108625786-108625808 GAACAAAAAGAAAATGAGCAAGG + Intergenic
1089994039 11:122887798-122887820 TAGCAAAAATAGACTGAGTAGGG + Intronic
1090584266 11:128193225-128193247 GAGAAAAAATAGAGTGAGAAAGG - Intergenic
1091775208 12:3180328-3180350 CAGAAAAAATAAAATTAGCCAGG + Intronic
1091811112 12:3398670-3398692 GAGAAAAAATGAAGTGAGCCCGG - Intronic
1092685652 12:11042612-11042634 AAAAAAAAAAAGAATGAGCCTGG - Intronic
1093943000 12:25075408-25075430 GAGCAAAAATAAAATAATCCTGG + Intronic
1094546329 12:31407758-31407780 CAGGAAAAAGACAATGAGCCTGG + Intronic
1094635913 12:32227117-32227139 GAGCAAAAATAGAACAAGGGGGG + Intronic
1094789071 12:33889386-33889408 GAGAAAATATAAACTGAGCCTGG + Intergenic
1095451187 12:42332043-42332065 GATAAAAAATAAAATTAGCCAGG + Intronic
1096084291 12:48855277-48855299 AAACAAAAACAGAATTAGCCGGG + Intergenic
1096884867 12:54707471-54707493 AAAAAAAAATAGAATTAGCCGGG + Intergenic
1098360539 12:69650281-69650303 TTGCAAAAAGAGAATGATCCTGG + Intronic
1099328956 12:81256514-81256536 GATCAAAGATACAATGAGCATGG - Exonic
1099971953 12:89509743-89509765 GAGCAAAGATATATTGAGCATGG - Intronic
1100200568 12:92293627-92293649 AAACAAAAATAAAATTAGCCAGG + Intergenic
1100621329 12:96277139-96277161 GAGGAAAAAAAGAATTAGCAAGG + Intergenic
1100732697 12:97490142-97490164 GAGAAATAGAAGAATGAGCCTGG + Intergenic
1101771511 12:107756097-107756119 GAAAAAAAAGAAAATGAGCCAGG + Intronic
1102161378 12:110771814-110771836 AAAGAAAAAAAGAATGAGCCAGG + Intergenic
1103679048 12:122678845-122678867 AAACAAAAATAAAATTAGCCAGG - Intergenic
1103755858 12:123206299-123206321 AAACAAAAAAAAAATGAGCCAGG + Intronic
1105566036 13:21549084-21549106 ATGCAAAAAAAAAATGAGCCAGG - Intronic
1105703397 13:22950793-22950815 GAGGAGAAATAGAAGGAGACAGG + Intergenic
1105904298 13:24790556-24790578 CAGCACAAATAGAATAAGACAGG - Intronic
1108247215 13:48530049-48530071 GAACAAAAAAAAAATGAGCCAGG - Intronic
1108271299 13:48762264-48762286 AAGCAAAGATAGAAAGAGCTGGG - Intergenic
1109956096 13:69568459-69568481 TAGCAAAAAAAAAATGATCCTGG - Intergenic
1110218962 13:73052658-73052680 GAGAAACAATAGTATGAGCTGGG + Intergenic
1110355683 13:74564190-74564212 GAGCAAAAATGAAATGAGAAAGG + Intergenic
1110613044 13:77510427-77510449 GAACAAAGATAGAAGGACCCTGG + Intergenic
1112027315 13:95423272-95423294 GAGAAAAAAAAAAATTAGCCGGG + Intergenic
1112492495 13:99880226-99880248 TACCAAAAATACAATGAGCCGGG - Intronic
1112833646 13:103485721-103485743 GAGCAAAAATAAAATGTCCATGG - Intergenic
1113865210 13:113517391-113517413 TACTAAAAATAGAATTAGCCGGG - Intronic
1113935556 13:113993170-113993192 AAGCAGACATAGAATGAGCAGGG - Intronic
1114516741 14:23305098-23305120 GAGCAAAAATGAAATGAGGATGG + Intronic
1115436689 14:33382924-33382946 CTACAAAAATAAAATGAGCCAGG + Intronic
1116759641 14:48995429-48995451 GGGCAAAAACAGAAGGAACCTGG + Intergenic
1116808403 14:49515861-49515883 GGGCAAACTGAGAATGAGCCAGG - Intergenic
1118886891 14:69874929-69874951 GAGAAATAATAGAAGGAGCCTGG + Intronic
1119020719 14:71110049-71110071 GACTGAAAATAGAATGAGCTTGG + Exonic
1119212000 14:72839012-72839034 GTGCAAAAATTGCTTGAGCCCGG - Intronic
1120018112 14:79497456-79497478 CAGATAAAATAGAATGAGCTAGG - Intronic
1120253498 14:82089197-82089219 GAGGAAAAATAGTGTGAGGCAGG - Intergenic
1120525819 14:85575739-85575761 GAGGGAAGACAGAATGAGCCTGG + Intronic
1121209932 14:92200517-92200539 TACCAAAAATAAAATGAGCCAGG - Intergenic
1123173434 14:106396198-106396220 TAAAAAAAATAGACTGAGCCAGG - Intergenic
1126395492 15:48211241-48211263 CAGCAACACTAGAATGGGCCTGG - Intronic
1126428112 15:48551233-48551255 GAGGAAAAATAGAAGGACCAGGG - Intronic
1126487637 15:49199849-49199871 GAGCAACAAGAGAATGAGGCAGG + Intronic
1126631247 15:50738250-50738272 GAACAAAAACTGAATGAGGCTGG + Intronic
1126730946 15:51681657-51681679 GAGTAAAAACAGGAAGAGCCAGG - Exonic
1126813345 15:52430859-52430881 GAAGAATAATAGAATGAACCTGG + Intronic
1127456051 15:59157063-59157085 GAGTAAAAAAAAAAAGAGCCAGG + Intronic
1127479607 15:59366278-59366300 GAGAAAAAAAAGAAAGAGACAGG - Intronic
1128299519 15:66557107-66557129 GTGGAAAGATGGAATGAGCCTGG + Intronic
1129648181 15:77457688-77457710 GAGCAGAAATAGCATGCACCTGG - Intronic
1131186335 15:90277612-90277634 AAAAAAAAATAGAATTAGCCAGG + Exonic
1131752884 15:95528314-95528336 GATGAAAAATATAATGAGGCAGG - Intergenic
1131875169 15:96798285-96798307 GAGAAAGAATAGTATGAGACAGG - Intergenic
1131938910 15:97539156-97539178 CATCAAAAAAAGAATGAGCATGG + Intergenic
1132872201 16:2120539-2120561 AAGGAAAAAAAGAATCAGCCAGG + Intronic
1133690458 16:8209662-8209684 GAGGAAAAAGAGGAGGAGCCAGG + Intergenic
1133882259 16:9793610-9793632 GACAAAGAATAGAATGGGCCAGG - Intronic
1134020747 16:10919749-10919771 AAGCAAAAATAGAATCTGTCTGG + Intronic
1134520327 16:14916356-14916378 AAGGAAAAAAAGAATCAGCCAGG - Intronic
1134551248 16:15139618-15139640 AAGGAAAAAAAGAATCAGCCAGG + Intergenic
1134708001 16:16315007-16315029 AAGGAAAAAAAGAATCAGCCAGG - Intergenic
1134715214 16:16355040-16355062 AAGGAAAAAAAGAATCAGCCAGG - Intergenic
1134951601 16:18353638-18353660 AAGGAAAAAAAGAATCAGCCAGG + Intergenic
1134959543 16:18397119-18397141 AAGGAAAAAAAGAATCAGCCAGG + Intergenic
1135506323 16:23039980-23040002 GAGAAAAAATAAAATTACCCAGG + Intergenic
1138376392 16:56567182-56567204 GAGAAAAAAAAAAATTAGCCAGG - Intronic
1138446740 16:57069366-57069388 GAGGAAAAATCGCTTGAGCCCGG + Intronic
1138748093 16:59386943-59386965 GAACACAAAAAGAATTAGCCAGG - Intergenic
1139434477 16:66928074-66928096 GAGCAAAAATAGACATGGCCGGG + Intergenic
1139489117 16:67277298-67277320 AATCAAAAATAAAATGGGCCGGG - Intergenic
1140085568 16:71793006-71793028 GAACATAAACAAAATGAGCCAGG + Intronic
1141480840 16:84305704-84305726 GATTAAAAATAAAAGGAGCCAGG + Intronic
1143361204 17:6372771-6372793 GAGAAAAAAAAGAAGGAGGCAGG + Intergenic
1144690030 17:17255315-17255337 AAACAAAAAAAGAATTAGCCAGG + Intronic
1144694740 17:17295144-17295166 AAGAAAAAAGAGAATGAGGCCGG - Intergenic
1146231703 17:31116970-31116992 TAATAAAAATAAAATGAGCCAGG - Intronic
1146713351 17:35062102-35062124 GAGCATAAAAAGAATGAACAAGG + Intronic
1146997133 17:37331069-37331091 AAATAAAAATAGAATTAGCCGGG - Intronic
1147331868 17:39704175-39704197 GAGCAAAGACAGTATGAGGCAGG - Intronic
1149416509 17:56465415-56465437 GACCTAAAAATGAATGAGCCAGG - Intronic
1149681087 17:58507645-58507667 TAGCTAAAATAGAGTGAGACAGG - Intronic
1149773390 17:59339038-59339060 AAGCAAAAACAGAAAGAGCAAGG - Intronic
1150164332 17:62927064-62927086 CAGCAAAAATAGAATAGACCAGG - Intergenic
1151386574 17:73758738-73758760 GAGAAAAAAAAAAATTAGCCAGG + Intergenic
1151592200 17:75052731-75052753 GGGAAAAAATAGAAACAGCCGGG + Intronic
1153255518 18:3166429-3166451 AAACAAAAAAAGAATTAGCCAGG - Intronic
1153879969 18:9413366-9413388 TAGAAAAAATAAAATTAGCCAGG + Intergenic
1154512832 18:15126864-15126886 GAACAAATATAGAATGAGAGAGG - Intergenic
1156259581 18:35432469-35432491 AAGGAAAAATAGAATGAGGGAGG + Intergenic
1156712138 18:39959830-39959852 GGGCACAACTAGAATGAGCTGGG + Intergenic
1161213150 19:3078581-3078603 TAGAAAAAAATGAATGAGCCAGG + Intergenic
1163412420 19:17163661-17163683 GACAGAAAATAGAATGGGCCAGG - Intronic
1163503878 19:17692643-17692665 TAAAAAAAATAAAATGAGCCAGG - Intergenic
1163627793 19:18400550-18400572 GAAAAAAAATAAAATGGGCCGGG + Intergenic
1164482416 19:28622701-28622723 GAGCAAAAACAGAAAGAGAAGGG + Intergenic
1165056082 19:33177142-33177164 GAGCAAAAATGGAAAGAGCTTGG - Intergenic
1165891399 19:39114514-39114536 TAGCAAAAATACAATTAGCTGGG + Intergenic
1166726606 19:45032256-45032278 AACCAAAAATAAAATTAGCCGGG + Intronic
1167009815 19:46800070-46800092 GTACAAAAATAAAATTAGCCGGG - Intergenic
1167354288 19:48993672-48993694 GAGCAAAAGGAGGAGGAGCCAGG + Exonic
1168238776 19:55078970-55078992 GGGGAGAAAGAGAATGAGCCTGG - Intronic
926026098 2:9545935-9545957 AAGTAAAAATAAAATTAGCCAGG + Intronic
927627038 2:24732740-24732762 GAGCAAAAAGAGAAAGAACCTGG - Intronic
929486069 2:42356019-42356041 GAAAAAAAACAGAATGGGCCGGG - Intronic
929594536 2:43168086-43168108 GAGGAAAACTAGCATGAGCTTGG + Intergenic
930059328 2:47275294-47275316 AAGTAAAAATACAATTAGCCAGG - Intergenic
930615216 2:53586733-53586755 GAGGAAAAATTAAAAGAGCCCGG - Intronic
931142447 2:59477814-59477836 ATGCAAAAAAAGAATTAGCCAGG - Intergenic
931229941 2:60365652-60365674 TTGCACAAATAGAACGAGCCGGG - Intergenic
931593745 2:63916572-63916594 AAGAAAAGATAGAAAGAGCCTGG + Intronic
933373060 2:81441921-81441943 GAGAAAAAATAAATTGAGCTGGG - Intergenic
935136679 2:100310280-100310302 GGGCAAAGGTAGAGTGAGCCAGG - Intronic
935253241 2:101284063-101284085 GAGCAAAGAGGGGATGAGCCAGG + Intronic
935874314 2:107489136-107489158 GAGCAAGCATAGAAAGAGCCTGG - Intergenic
936066730 2:109338026-109338048 CATCAAAAACAGAAGGAGCCTGG - Intronic
937126897 2:119480881-119480903 GAGCCCAAAAAGAAAGAGCCAGG + Intronic
937961877 2:127466335-127466357 GAGCAAGAATAGAAGTAGCAAGG - Intronic
938304553 2:130243192-130243214 GGGAAAAAAGAGAATGTGCCTGG + Intergenic
938539837 2:132276845-132276867 AGGCAAATATAGAATGAGCCAGG + Intergenic
939527816 2:143319383-143319405 TATCAAAAATACAATTAGCCAGG - Intronic
941070907 2:160953501-160953523 GAGCAAAAAGAGACACAGCCTGG - Intergenic
941680692 2:168395529-168395551 GAGCAAAAATAGAGTAATGCTGG + Intergenic
944280753 2:197893896-197893918 GAGCAAAAAGTCAAAGAGCCTGG - Intronic
944357177 2:198804849-198804871 GTGGAAAGATAGATTGAGCCTGG - Intergenic
944675369 2:202031113-202031135 AAGCAAAATTAAAATGATCCTGG + Intergenic
944858487 2:203791509-203791531 GAGCAAAGATAGAAGGACCTGGG + Intergenic
945450528 2:209989682-209989704 GTGCAATACTAGAATGAACCAGG - Intronic
945953288 2:216060995-216061017 AATCAAAAATGGAATGAGCCGGG + Intronic
946157099 2:217814171-217814193 AAACAAAAAGAAAATGAGCCAGG - Intronic
946483462 2:220078454-220078476 GAGGAAGAAGAGAAGGAGCCTGG + Intergenic
946762792 2:223011806-223011828 GTGCAAAAATAGAATTACCTTGG + Intergenic
947849639 2:233275325-233275347 GAGCAGAAATTGAACCAGCCTGG + Intronic
1169102606 20:2964285-2964307 GAGCAGAACAAGAATGAACCAGG - Exonic
1171231669 20:23491734-23491756 GACCCAAAAAAGAATGAGACAGG + Exonic
1171868773 20:30509887-30509909 AGGCAAATATAGAATAAGCCAGG + Intergenic
1172577730 20:36022173-36022195 GAAAAAAAAAAGAATTAGCCGGG - Intronic
1173999364 20:47363104-47363126 GAACAAAAATAAAAAGTGCCTGG + Intergenic
1174019262 20:47516764-47516786 GTACAAAAATAAAATTAGCCAGG + Intronic
1174049205 20:47755907-47755929 GAGCAAAAAAAAAAAGTGCCAGG - Intronic
1175324608 20:58114395-58114417 CACCAAGAAGAGAATGAGCCCGG + Intergenic
1175792295 20:61747285-61747307 AAACAAAAATAAAATTAGCCGGG + Intronic
1176302100 21:5103320-5103342 AAACAAAAACAGAATTAGCCGGG + Intergenic
1177086873 21:16716543-16716565 TAACCAAAATAGAATGGGCCTGG - Intergenic
1177161566 21:17553780-17553802 TACCAAAAATAAAATCAGCCAGG - Intronic
1177860883 21:26452516-26452538 GAGCCAAAATAGAATGAGTTAGG - Intergenic
1177889417 21:26787284-26787306 GAGCCAAATTTGAATAAGCCTGG + Intergenic
1179854929 21:44158575-44158597 AAACAAAAACAGAATTAGCCGGG - Intergenic
1179919803 21:44501601-44501623 AAGAAAAAATAAAATTAGCCAGG + Intronic
1181723986 22:24798416-24798438 GAGTTAAAATACAAAGAGCCTGG + Intergenic
1181953729 22:26573192-26573214 GACAAAAAATAAAATTAGCCAGG - Intronic
1182382963 22:29908436-29908458 GAGTAAAAATAGAATGAAAGTGG + Intronic
1183122141 22:35738305-35738327 GAACAAAAAGTGAAGGAGCCTGG + Intergenic
1183835776 22:40451784-40451806 GAGTGAAAATAGACTGATCCAGG - Intronic
949629089 3:5903013-5903035 GATCAGAAATGAAATGAGCCGGG - Intergenic
950543063 3:13623704-13623726 GATTAAAAATTGAAAGAGCCAGG - Intronic
951152399 3:19306920-19306942 GAGCAAAAAAAGAAGAAACCTGG + Intronic
951493080 3:23294858-23294880 GACCAAAAATATAATGATGCAGG + Intronic
952026814 3:29092723-29092745 GTGCCAAAACAGAATGGGCCTGG - Intergenic
952130959 3:30362439-30362461 GGGCAAATATAAAATGATCCAGG + Intergenic
952307198 3:32156780-32156802 GATGAAAAACAGAATGAGCTGGG - Intronic
952371033 3:32722913-32722935 GAGGAAAACTAGACTGAGCTCGG - Intronic
952954215 3:38546772-38546794 GATCAAAACTACAATGAGGCCGG + Intergenic
953116890 3:40001752-40001774 CAGCAAAACTAGAATGGACCAGG + Intronic
953697300 3:45170073-45170095 GAGCACAAATACACAGAGCCAGG - Intergenic
953713051 3:45291450-45291472 GATCAAAAATAAAATCAGGCCGG - Intergenic
955261629 3:57396862-57396884 CAGGAAAAAAAGAATTAGCCAGG + Intronic
956003537 3:64754215-64754237 CTGCAAAATTAGAATGAGCTTGG - Intergenic
956392355 3:68786956-68786978 GAGAAAAAATAAAAAGAGTCAGG + Intronic
956449808 3:69363118-69363140 GTGGAAAAATAGAAGAAGCCTGG - Intronic
956803549 3:72786182-72786204 CAGGAAAAATAGCCTGAGCCAGG - Intronic
958133259 3:89457009-89457031 GAGCAAAAATAAAAGGAGTTCGG + Intronic
958717874 3:97808830-97808852 GAAAAAATACAGAATGAGCCTGG + Intergenic
958914721 3:100036309-100036331 GAGGAAAAAAAAGATGAGCCTGG + Intronic
959563162 3:107805677-107805699 GAGCAGAAACAGAATGATCCTGG + Exonic
959818260 3:110702005-110702027 ATGCAAAAATAGAATCAGCCTGG - Intergenic
959984221 3:112555724-112555746 GAGTTAGAGTAGAATGAGCCTGG - Intronic
961240553 3:125407102-125407124 GAAAAAAAAAAAAATGAGCCAGG - Intergenic
961955430 3:130797414-130797436 GAACAAAAAAACCATGAGCCGGG - Intergenic
962646648 3:137447186-137447208 GGGCCAAGATAGAAGGAGCCTGG + Intergenic
962670470 3:137700947-137700969 GAGCAAAAATAGAATAAACAGGG - Intergenic
964865030 3:161248192-161248214 GAGCAAAAATAAATTTAGCCGGG + Intronic
965428404 3:168556140-168556162 AAACAACAATAGAATGAGACAGG - Intergenic
965795035 3:172430771-172430793 GTGCAAAAACAAAATCAGCCAGG + Intergenic
966803076 3:183782722-183782744 GAACAAAAATAGAATCACTCTGG - Intronic
968551780 4:1227035-1227057 GAGAAAAAACAGACCGAGCCTGG + Intronic
969011523 4:4067606-4067628 TACCAAAAATACAATTAGCCAGG + Intergenic
969531306 4:7732619-7732641 GACCAAGAAGAGAATGAGACAGG - Intronic
969742551 4:9042281-9042303 TACCAAAAATACAATTAGCCAGG - Intergenic
969934603 4:10668154-10668176 GAGCAAACATAAACTGAGCCTGG + Intronic
970519031 4:16863953-16863975 AAGCAAGAAGAGAATGTGCCAGG - Intronic
971285330 4:25283760-25283782 TACTAAAAATAGAATTAGCCGGG + Intergenic
971738950 4:30496180-30496202 GAGGCAAAATAGAAGCAGCCTGG - Intergenic
972578257 4:40371918-40371940 GTTCAAAAATAGAATTAGCTGGG - Intergenic
972920003 4:43927311-43927333 GAGTAAAAACATAATGGGCCGGG + Intergenic
973318887 4:48789840-48789862 GAGGAAAGAGAGAATAAGCCTGG - Intergenic
973681710 4:53327335-53327357 GAGCCAAAATGGAATGAGAAGGG + Intronic
973942987 4:55928863-55928885 GAGCAAAAATGGAAGGATCTGGG + Intergenic
974156699 4:58082720-58082742 GAGAAAAAAAAGACAGAGCCTGG - Intergenic
974531293 4:63111041-63111063 GAGCAAAAACAGCAGGAGCCGGG + Intergenic
976470254 4:85420019-85420041 GAGAAAAAATAGAATAAGTGAGG - Intergenic
977034446 4:91932152-91932174 GAGCAAAAAGAAAATGGGCCAGG + Intergenic
977118901 4:93071682-93071704 GAGCCAAAATAGAGTGAGAAAGG + Intronic
978737338 4:112098867-112098889 GAGCAAAAAGAGAAAGAACAAGG + Intergenic
979632207 4:122916130-122916152 CAGCAAAAACAGAAACAGCCAGG + Intronic
981526722 4:145714076-145714098 GTCTAAAAATAAAATGAGCCAGG - Intronic
981545967 4:145893538-145893560 AAACAAAAATAGAATTACCCTGG - Intronic
982659878 4:158193863-158193885 AAGCAAAAGTTGACTGAGCCTGG - Intergenic
983082679 4:163406392-163406414 GGGCACAAAGAGAAAGAGCCTGG + Intergenic
984589879 4:181605292-181605314 AAGAAAAAAAAGAATTAGCCGGG + Intergenic
985472046 5:52785-52807 AAGTAAAAATAAAATTAGCCTGG - Intergenic
987291182 5:16509831-16509853 TACCAAAAATAAAATTAGCCGGG + Intronic
988168654 5:27626930-27626952 ATGCAAAAATAAAATTAGCCGGG + Intergenic
988847298 5:35141145-35141167 GAACAAAGATAGAAGGAGTCTGG + Intronic
988914470 5:35878529-35878551 GAGGAAAAGTAGAATCTGCCTGG + Exonic
989255923 5:39365579-39365601 CTGCAAAAATAGAATGACCTGGG + Intronic
989466538 5:41762812-41762834 GATCAAAAATAGAATGATAATGG - Intronic
990263043 5:54046183-54046205 GATTAAAAATAGAATGGGCTGGG + Intronic
990703236 5:58498001-58498023 GAGGAAATAGAGAAAGAGCCTGG - Intergenic
991647596 5:68816772-68816794 GAGCAAAAGTAACAGGAGCCAGG + Intergenic
992451369 5:76879259-76879281 GAAAAAAGATAGAAGGAGCCTGG + Intronic
994781810 5:104098575-104098597 GAGCAAAAAAAGGATGAGGACGG - Intergenic
994997103 5:107078153-107078175 GAGAAAAAATAGAAATAGGCCGG + Intergenic
995469256 5:112483299-112483321 GAGCAAAAATAGATGAAACCTGG - Intergenic
996470894 5:123859475-123859497 TACCAAAAATAAAATTAGCCAGG - Intergenic
996981250 5:129497869-129497891 GACCAAAAGTAGAATGAGGGAGG - Intronic
998729464 5:145058075-145058097 GAGCAATAAGATAATGAGGCTGG + Intergenic
1000001834 5:157145965-157145987 GAGCAAAGAAAGAAAGAGCAGGG + Intronic
1000043695 5:157504229-157504251 CAACAAAAAAAGAATGAGGCAGG - Intronic
1000518686 5:162273106-162273128 GAGCAGAAACAGAATTAACCTGG + Intergenic
1000772960 5:165379834-165379856 GAGAAAAAATAAAATAGGCCGGG + Intergenic
1004648208 6:17583295-17583317 TAGTAAGAATAAAATGAGCCAGG + Intergenic
1004947243 6:20629624-20629646 GAGCAGAAATGGAGTGAGGCAGG - Intronic
1004962345 6:20804323-20804345 GAGAGAAAATAGAATGAGAGAGG + Intronic
1005500463 6:26424813-26424835 GATAAAAATTAAAATGAGCCTGG + Intergenic
1006352126 6:33528713-33528735 GAAAAAAAACAGAAGGAGCCTGG + Intergenic
1006528705 6:34630808-34630830 GAATAAAAATAGAACAAGCCAGG - Intronic
1007467887 6:42067726-42067748 TAGGAAAAATAAAATTAGCCAGG - Intronic
1010389173 6:75317794-75317816 GAGCACACAGAGAATGAGCCTGG - Intronic
1011229105 6:85139941-85139963 AAGCAGAAATAGAAATAGCCAGG - Intergenic
1011349466 6:86406801-86406823 AAGCAAAAAAAAAATTAGCCAGG - Intergenic
1011573029 6:88760972-88760994 AAAAAAAAATAGAATGAGCTGGG - Intronic
1012819623 6:104069541-104069563 GAGAAAAAATGAAATGAGACAGG + Intergenic
1013722790 6:113051116-113051138 GAGCAGAAATCTAATTAGCCAGG + Intergenic
1014148246 6:118022909-118022931 AAGAAAAAAAAGAATTAGCCCGG - Intronic
1014431794 6:121379744-121379766 AAGCAAAAATAGACAGGGCCAGG - Intergenic
1015064775 6:129011206-129011228 GAGCAAAAAGAGAAGGAGAGAGG - Intronic
1015765621 6:136712851-136712873 CAGACAAGATAGAATGAGCCAGG - Intronic
1016415805 6:143832499-143832521 CAACAAAAAAAGAATTAGCCAGG - Intronic
1016645784 6:146406671-146406693 ATGCAAAAATAAAATTAGCCAGG + Intronic
1018536218 6:164822830-164822852 ACGAAAAAATAGAATGAGCTGGG + Intergenic
1019961069 7:4460232-4460254 GAGCAAAAACAAAATGTCCCAGG - Intergenic
1020269325 7:6583778-6583800 TAACAAAAATAGAATGTGGCTGG + Intronic
1020595001 7:10195453-10195475 GAGAAAAAAAAGAAAGAGACAGG - Intergenic
1021167176 7:17355582-17355604 AAGAAAAAATAGAATGAGCCTGG + Intergenic
1021220606 7:17971198-17971220 GAACAAAAATATATTCAGCCTGG - Intergenic
1021258446 7:18423737-18423759 GAGCAAAAGTAGAAAGTGCCAGG + Intronic
1021612309 7:22470172-22470194 GAGAAAATACAAAATGAGCCTGG + Intronic
1021805161 7:24348226-24348248 GAGCAAAAATATAAAGAGGTGGG - Intergenic
1021939520 7:25665873-25665895 AAGCAAGAGGAGAATGAGCCAGG + Intergenic
1023742465 7:43293057-43293079 TACTAAAAATAGAATTAGCCGGG + Intronic
1023957245 7:44896295-44896317 GAGAAAACATAAATTGAGCCTGG + Intergenic
1024337787 7:48226706-48226728 GTGCAAAAATAGAAGGAACATGG - Intronic
1026521520 7:71122208-71122230 TAGCAAATATAGAATGAGAAAGG + Intergenic
1026961269 7:74409275-74409297 AAAAAAAAATAGAATGGGCCGGG + Intergenic
1027298196 7:76800175-76800197 TAGCAGAACTAGAATGGGCCAGG + Intergenic
1028152597 7:87391312-87391334 GAGCATAAATAGCAGGAGGCAGG + Intronic
1028305761 7:89262324-89262346 GAGCAAGAAAATAATGAGCATGG - Intronic
1028646187 7:93099127-93099149 GAGCTGAAATGAAATGAGCCAGG + Intergenic
1029070815 7:97895628-97895650 TACCAAAAATACAATTAGCCAGG + Intergenic
1029300286 7:99577498-99577520 GCGCAACAATAGCTTGAGCCTGG + Intronic
1029733491 7:102452735-102452757 GACAAAAAACAGAATGGGCCAGG - Exonic
1030758784 7:113324410-113324432 GAGCAGAAACACAATGAGACAGG - Intergenic
1032118303 7:129136255-129136277 GCAGAAAAATAGAAGGAGCCTGG + Intergenic
1034032636 7:147785200-147785222 GAGAGAAAATAGAATGAAACAGG + Intronic
1034649566 7:152679094-152679116 TACCAAAAATACAATTAGCCAGG - Intergenic
1035916406 8:3629133-3629155 GAGCAAAGACAGAAAGAACCCGG + Intronic
1036374146 8:8185835-8185857 GAAAAAAAAAAAAATGAGCCAGG + Intergenic
1036876757 8:12479804-12479826 GAAAAAAAAAAAAATGAGCCAGG - Intergenic
1036894112 8:12617956-12617978 TACCAAAAATACAATTAGCCAGG + Intergenic
1037107975 8:15132980-15133002 GAACACAAATAAAATTAGCCAGG + Intronic
1037718560 8:21421247-21421269 GAGCAAAATCAGTATCAGCCAGG + Intergenic
1037853375 8:22351055-22351077 GACCAAGAATTGCATGAGCCTGG + Intronic
1038067029 8:23974092-23974114 GAGAAAAAATAAACAGAGCCAGG + Intergenic
1038822280 8:30963839-30963861 AAAAAAAAAAAGAATGAGCCTGG - Intergenic
1038948221 8:32385178-32385200 GAGAAAAAAAAAAATTAGCCGGG - Intronic
1039055541 8:33533404-33533426 AAAAAAAAAAAGAATGAGCCGGG - Intergenic
1039530277 8:38255032-38255054 TACCAAAAATACAATTAGCCAGG + Intronic
1042166384 8:65950022-65950044 GAGCTGAAGTATAATGAGCCAGG + Intergenic
1042467544 8:69145078-69145100 GTACAAAATGAGAATGAGCCTGG + Intergenic
1042621838 8:70715326-70715348 AAGCAAGAATAGAAAGAGACAGG + Intronic
1042874642 8:73429829-73429851 GAGAAACAATAGAATGAGTGTGG - Intronic
1042883382 8:73520033-73520055 GAGCAATGAGAGAATGGGCCAGG + Intronic
1046168697 8:110475717-110475739 GAGTAAAAATATATTAAGCCAGG + Intergenic
1046594437 8:116244702-116244724 GAACAAAGACAGAATGATCCAGG - Intergenic
1047900918 8:129421815-129421837 GAGTAAAAAGAGAATGAAACGGG + Intergenic
1048340869 8:133537517-133537539 GGGCTACAAAAGAATGAGCCAGG + Intronic
1050628127 9:7528875-7528897 AAACAAAAATAAAATTAGCCAGG + Intergenic
1050756814 9:9015060-9015082 GTGTAAAAAAAGAATAAGCCAGG + Intronic
1051227296 9:14913722-14913744 CAGCAAAACTTTAATGAGCCTGG + Intergenic
1051583239 9:18699771-18699793 AATCAAAAATATAATGATCCTGG - Intronic
1052220225 9:26012689-26012711 GAGCAAAAATAAAATCAGTTAGG - Intergenic
1052558856 9:30057252-30057274 GAGCAAAAACAGGAAGAGCAAGG - Intergenic
1052807283 9:33024803-33024825 GAGCAAAAAATGCTTGAGCCAGG - Intronic
1053444376 9:38140431-38140453 GGAGAAAAATAGAAAGAGCCAGG - Intergenic
1054915006 9:70487421-70487443 AATAAAAAATAAAATGAGCCTGG + Intergenic
1055079225 9:72251332-72251354 GATTAAAAATAGGAAGAGCCTGG - Intronic
1055910727 9:81347792-81347814 GATAGAAAATAGAATGAGGCTGG - Intergenic
1056278968 9:85021220-85021242 GATCAAAGATAGGATGAGACAGG - Intronic
1056447929 9:86684329-86684351 GAACTAAAATACAAAGAGCCAGG - Intergenic
1058455045 9:105130870-105130892 GGGCAAAAAAAGAATGAGGCTGG + Intergenic
1059242824 9:112822075-112822097 TACCAAAAAAAGAATTAGCCAGG - Intronic
1059293797 9:113251450-113251472 GAGCAAAGATTGTATGACCCTGG + Intronic
1059586530 9:115613572-115613594 GAGCAAAAAAAGAATAAGATAGG - Intergenic
1059735499 9:117095845-117095867 AAGCAAATAAAGAATAAGCCAGG + Intronic
1059830053 9:118085290-118085312 GCCAAAAAATAGAAGGAGCCTGG - Intergenic
1060336593 9:122729558-122729580 AACCAAAAATAAAATCAGCCAGG - Intergenic
1060896945 9:127224606-127224628 GAGCTACAATAGAAAGGGCCAGG + Intronic
1060958080 9:127658693-127658715 GGGGAAAACTAGAATGATCCAGG - Intronic
1061919025 9:133772112-133772134 CAGCAAACACAGAATGAGCCTGG - Intronic
1185803103 X:3030990-3031012 GAAAAAAAAAAGAATTAGCCAGG + Intronic
1185881088 X:3741579-3741601 AAACAAAAATAAAATTAGCCGGG + Intergenic
1185954192 X:4471207-4471229 AAGCAAAAAGAAAATGAGCCAGG + Intergenic
1186114554 X:6291938-6291960 GTTCAAAAATAGTATTAGCCTGG + Intergenic
1186794878 X:13036498-13036520 GAGCAAAAACAGAAAAAGACTGG + Exonic
1187475705 X:19609063-19609085 GAGCAAAAATGGCAAGAGCCTGG + Intronic
1188251035 X:27894606-27894628 GAGCAAATATAGTAGGACCCAGG + Intergenic
1188462031 X:30439305-30439327 CAGCTAAAAAATAATGAGCCAGG + Intergenic
1189186520 X:39059946-39059968 GATAAAAAATAAAATGGGCCAGG + Intergenic
1189429970 X:40937712-40937734 TAGCAAAAATAAAATCAGCGAGG + Intergenic
1189518188 X:41737110-41737132 GAGCAAAAATGGAAGGTGCTAGG - Intronic
1189941135 X:46122424-46122446 AAGCAAAACTACAATGGGCCAGG - Intergenic
1190460014 X:50663240-50663262 AAACAAAAATAGAAAGAGCTAGG - Intronic
1192100485 X:68259159-68259181 CATCAATAAGAGAATGAGCCTGG + Intronic
1192177155 X:68893251-68893273 GAGCAGAAAGGGCATGAGCCAGG - Intergenic
1192749952 X:73979101-73979123 GAACATAAAAATAATGAGCCAGG - Intergenic
1193484408 X:82069068-82069090 GAACAAAAATTTGATGAGCCTGG + Intergenic
1193628208 X:83846074-83846096 CAGCAGAAATTGTATGAGCCAGG + Intergenic
1197047612 X:122017812-122017834 GAGAAAATATTTAATGAGCCAGG - Intergenic
1198105352 X:133456242-133456264 TATAAGAAATAGAATGAGCCCGG - Intergenic
1200086242 X:153608025-153608047 AATCAAAACTAGAATGAGGCTGG + Intergenic
1200977229 Y:9226239-9226261 AAAAAAAAAAAGAATGAGCCAGG - Intergenic
1201742409 Y:17337955-17337977 AAGCAAAAAGAAAATGAGCAAGG + Intergenic
1201983734 Y:19938252-19938274 AAGCTAAAATAGATTGAGCTGGG + Intergenic
1202056095 Y:20831883-20831905 AAGCTAAAATAGATTGAGCTGGG + Intergenic