ID: 1065424767

View in Genome Browser
Species Human (GRCh38)
Location 10:25588378-25588400
Sequence CTGGCTTCAGTGATCAAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065424765_1065424767 12 Left 1065424765 10:25588343-25588365 CCTCGTTCTTAGCTGCTACACTG No data
Right 1065424767 10:25588378-25588400 CTGGCTTCAGTGATCAAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065424767 Original CRISPR CTGGCTTCAGTGATCAAACA AGG Intronic
No off target data available for this crispr