ID: 1065426997

View in Genome Browser
Species Human (GRCh38)
Location 10:25616109-25616131
Sequence CAGCTGACACCCGCCCATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065426997_1065427000 12 Left 1065426997 10:25616109-25616131 CCTTTATGGGCGGGTGTCAGCTG No data
Right 1065427000 10:25616144-25616166 TTTTGCTTTCTGCTGTGTTAAGG No data
1065426997_1065427001 23 Left 1065426997 10:25616109-25616131 CCTTTATGGGCGGGTGTCAGCTG No data
Right 1065427001 10:25616155-25616177 GCTGTGTTAAGGCAGCACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065426997 Original CRISPR CAGCTGACACCCGCCCATAA AGG (reversed) Intergenic
No off target data available for this crispr