ID: 1065428341

View in Genome Browser
Species Human (GRCh38)
Location 10:25628786-25628808
Sequence GAGGTGGAGGCCATCATCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065428341_1065428347 3 Left 1065428341 10:25628786-25628808 CCGAGGATGATGGCCTCCACCTC No data
Right 1065428347 10:25628812-25628834 CTGTGTTGCTGCAAAGGACATGG No data
1065428341_1065428348 21 Left 1065428341 10:25628786-25628808 CCGAGGATGATGGCCTCCACCTC No data
Right 1065428348 10:25628830-25628852 CATGGCCTTGTTTTGTTTTATGG No data
1065428341_1065428345 -3 Left 1065428341 10:25628786-25628808 CCGAGGATGATGGCCTCCACCTC No data
Right 1065428345 10:25628806-25628828 CTCCATCTGTGTTGCTGCAAAGG 0: 21
1: 158
2: 956
3: 3011
4: 5887

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065428341 Original CRISPR GAGGTGGAGGCCATCATCCT CGG (reversed) Intergenic
No off target data available for this crispr