ID: 1065428344

View in Genome Browser
Species Human (GRCh38)
Location 10:25628805-25628827
Sequence CTTTGCAGCAACACAGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065428344_1065428350 15 Left 1065428344 10:25628805-25628827 CCTCCATCTGTGTTGCTGCAAAG No data
Right 1065428350 10:25628843-25628865 TGTTTTATGGCTGCATAATACGG No data
1065428344_1065428348 2 Left 1065428344 10:25628805-25628827 CCTCCATCTGTGTTGCTGCAAAG No data
Right 1065428348 10:25628830-25628852 CATGGCCTTGTTTTGTTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065428344 Original CRISPR CTTTGCAGCAACACAGATGG AGG (reversed) Intergenic
No off target data available for this crispr