ID: 1065428345

View in Genome Browser
Species Human (GRCh38)
Location 10:25628806-25628828
Sequence CTCCATCTGTGTTGCTGCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 10033
Summary {0: 21, 1: 158, 2: 956, 3: 3011, 4: 5887}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065428338_1065428345 18 Left 1065428338 10:25628765-25628787 CCTGTTGCTGTGGTTAGTTCACC No data
Right 1065428345 10:25628806-25628828 CTCCATCTGTGTTGCTGCAAAGG 0: 21
1: 158
2: 956
3: 3011
4: 5887
1065428341_1065428345 -3 Left 1065428341 10:25628786-25628808 CCGAGGATGATGGCCTCCACCTC No data
Right 1065428345 10:25628806-25628828 CTCCATCTGTGTTGCTGCAAAGG 0: 21
1: 158
2: 956
3: 3011
4: 5887

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065428345 Original CRISPR CTCCATCTGTGTTGCTGCAA AGG Intergenic
Too many off-targets to display for this crispr