ID: 1065428346

View in Genome Browser
Species Human (GRCh38)
Location 10:25628808-25628830
Sequence GTCCTTTGCAGCAACACAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 10612
Summary {0: 19, 1: 146, 2: 984, 3: 2867, 4: 6596}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065428346_1065428348 -1 Left 1065428346 10:25628808-25628830 CCATCTGTGTTGCTGCAAAGGAC 0: 19
1: 146
2: 984
3: 2867
4: 6596
Right 1065428348 10:25628830-25628852 CATGGCCTTGTTTTGTTTTATGG No data
1065428346_1065428350 12 Left 1065428346 10:25628808-25628830 CCATCTGTGTTGCTGCAAAGGAC 0: 19
1: 146
2: 984
3: 2867
4: 6596
Right 1065428350 10:25628843-25628865 TGTTTTATGGCTGCATAATACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065428346 Original CRISPR GTCCTTTGCAGCAACACAGA TGG (reversed) Intergenic
Too many off-targets to display for this crispr