ID: 1065428347

View in Genome Browser
Species Human (GRCh38)
Location 10:25628812-25628834
Sequence CTGTGTTGCTGCAAAGGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065428338_1065428347 24 Left 1065428338 10:25628765-25628787 CCTGTTGCTGTGGTTAGTTCACC No data
Right 1065428347 10:25628812-25628834 CTGTGTTGCTGCAAAGGACATGG No data
1065428341_1065428347 3 Left 1065428341 10:25628786-25628808 CCGAGGATGATGGCCTCCACCTC No data
Right 1065428347 10:25628812-25628834 CTGTGTTGCTGCAAAGGACATGG No data
1065428342_1065428347 -10 Left 1065428342 10:25628799-25628821 CCTCCACCTCCATCTGTGTTGCT No data
Right 1065428347 10:25628812-25628834 CTGTGTTGCTGCAAAGGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065428347 Original CRISPR CTGTGTTGCTGCAAAGGACA TGG Intergenic
No off target data available for this crispr