ID: 1065428350

View in Genome Browser
Species Human (GRCh38)
Location 10:25628843-25628865
Sequence TGTTTTATGGCTGCATAATA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065428342_1065428350 21 Left 1065428342 10:25628799-25628821 CCTCCACCTCCATCTGTGTTGCT No data
Right 1065428350 10:25628843-25628865 TGTTTTATGGCTGCATAATACGG No data
1065428343_1065428350 18 Left 1065428343 10:25628802-25628824 CCACCTCCATCTGTGTTGCTGCA No data
Right 1065428350 10:25628843-25628865 TGTTTTATGGCTGCATAATACGG No data
1065428344_1065428350 15 Left 1065428344 10:25628805-25628827 CCTCCATCTGTGTTGCTGCAAAG No data
Right 1065428350 10:25628843-25628865 TGTTTTATGGCTGCATAATACGG No data
1065428346_1065428350 12 Left 1065428346 10:25628808-25628830 CCATCTGTGTTGCTGCAAAGGAC 0: 19
1: 146
2: 984
3: 2867
4: 6596
Right 1065428350 10:25628843-25628865 TGTTTTATGGCTGCATAATACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065428350 Original CRISPR TGTTTTATGGCTGCATAATA CGG Intergenic
No off target data available for this crispr