ID: 1065428771

View in Genome Browser
Species Human (GRCh38)
Location 10:25632416-25632438
Sequence AGCTATCTGCATAAAATGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065428771_1065428779 1 Left 1065428771 10:25632416-25632438 CCCCCCATTTTATGCAGATAGCT No data
Right 1065428779 10:25632440-25632462 TATCAGACTTGCTGGGAGGATGG No data
1065428771_1065428776 -7 Left 1065428771 10:25632416-25632438 CCCCCCATTTTATGCAGATAGCT No data
Right 1065428776 10:25632432-25632454 GATAGCTGTATCAGACTTGCTGG No data
1065428771_1065428777 -6 Left 1065428771 10:25632416-25632438 CCCCCCATTTTATGCAGATAGCT No data
Right 1065428777 10:25632433-25632455 ATAGCTGTATCAGACTTGCTGGG No data
1065428771_1065428778 -3 Left 1065428771 10:25632416-25632438 CCCCCCATTTTATGCAGATAGCT No data
Right 1065428778 10:25632436-25632458 GCTGTATCAGACTTGCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065428771 Original CRISPR AGCTATCTGCATAAAATGGG GGG (reversed) Intergenic
No off target data available for this crispr