ID: 1065428776

View in Genome Browser
Species Human (GRCh38)
Location 10:25632432-25632454
Sequence GATAGCTGTATCAGACTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065428774_1065428776 -10 Left 1065428774 10:25632419-25632441 CCCATTTTATGCAGATAGCTGTA No data
Right 1065428776 10:25632432-25632454 GATAGCTGTATCAGACTTGCTGG No data
1065428770_1065428776 -2 Left 1065428770 10:25632411-25632433 CCAGACCCCCCATTTTATGCAGA No data
Right 1065428776 10:25632432-25632454 GATAGCTGTATCAGACTTGCTGG No data
1065428772_1065428776 -8 Left 1065428772 10:25632417-25632439 CCCCCATTTTATGCAGATAGCTG No data
Right 1065428776 10:25632432-25632454 GATAGCTGTATCAGACTTGCTGG No data
1065428771_1065428776 -7 Left 1065428771 10:25632416-25632438 CCCCCCATTTTATGCAGATAGCT No data
Right 1065428776 10:25632432-25632454 GATAGCTGTATCAGACTTGCTGG No data
1065428773_1065428776 -9 Left 1065428773 10:25632418-25632440 CCCCATTTTATGCAGATAGCTGT No data
Right 1065428776 10:25632432-25632454 GATAGCTGTATCAGACTTGCTGG No data
1065428768_1065428776 17 Left 1065428768 10:25632392-25632414 CCAGCTGCACAGTCCTTATCCAG No data
Right 1065428776 10:25632432-25632454 GATAGCTGTATCAGACTTGCTGG No data
1065428767_1065428776 18 Left 1065428767 10:25632391-25632413 CCCAGCTGCACAGTCCTTATCCA No data
Right 1065428776 10:25632432-25632454 GATAGCTGTATCAGACTTGCTGG No data
1065428769_1065428776 4 Left 1065428769 10:25632405-25632427 CCTTATCCAGACCCCCCATTTTA No data
Right 1065428776 10:25632432-25632454 GATAGCTGTATCAGACTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065428776 Original CRISPR GATAGCTGTATCAGACTTGC TGG Intergenic
No off target data available for this crispr