ID: 1065428850

View in Genome Browser
Species Human (GRCh38)
Location 10:25633246-25633268
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065428845_1065428850 24 Left 1065428845 10:25633199-25633221 CCTTTGGGCCAAGAGCTTTGTTC No data
Right 1065428850 10:25633246-25633268 GGTCAGATTTAACACCCCTAGGG No data
1065428846_1065428850 16 Left 1065428846 10:25633207-25633229 CCAAGAGCTTTGTTCGCAGAGAT No data
Right 1065428850 10:25633246-25633268 GGTCAGATTTAACACCCCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065428850 Original CRISPR GGTCAGATTTAACACCCCTA GGG Intergenic